ID: 967197532

View in Genome Browser
Species Human (GRCh38)
Location 3:187041595-187041617
Sequence CAGTTCTGTGCATGTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967197531_967197532 -10 Left 967197531 3:187041582-187041604 CCAGAGCTTCTTGCAGTTCTGTG 0: 1
1: 0
2: 0
3: 32
4: 317
Right 967197532 3:187041595-187041617 CAGTTCTGTGCATGTTGTACTGG 0: 1
1: 0
2: 1
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967197532 Original CRISPR CAGTTCTGTGCATGTTGTAC TGG Intronic
900689107 1:3969019-3969041 CAGTTCCGTGCATGTTGATGGGG - Intergenic
906847906 1:49214292-49214314 CATTTTTGTGCATCGTGTACTGG - Intronic
907185472 1:52605777-52605799 CAGTTCTCGCCATGTTGTCCAGG - Intronic
908585750 1:65565933-65565955 CTGGTCTGTACATGTTGTTCTGG + Intronic
912143703 1:106764459-106764481 CAGTTCTGTCATTGTTGTACTGG - Intergenic
912887561 1:113491028-113491050 GAGTTCTGTGGATGTTGATCAGG - Intronic
915249909 1:154580501-154580523 CATTTCTGTCCATGTGGAACCGG + Intergenic
916819300 1:168382449-168382471 CAGTTCAGTACTTGTTCTACTGG + Intergenic
917523236 1:175765267-175765289 CTGGGCTGTGCATGTTGTAGAGG - Intergenic
1065881788 10:30043506-30043528 CTCTTCTGTGGATGTTGTAAAGG - Intronic
1067311455 10:45117653-45117675 CATTTGTGTCCATATTGTACAGG - Intergenic
1072766474 10:98098576-98098598 CAGTCCTGTGAATGTTTTCCAGG - Intergenic
1073619544 10:105032384-105032406 CATTTCTATGTATGTTGTAGTGG - Intronic
1074518337 10:114193316-114193338 CAGTTTTGTTCTTGTTGTCCAGG + Intronic
1078085122 11:8229367-8229389 CAGGTCTGGGCATGTTGCAAGGG - Intronic
1079733037 11:23960085-23960107 CATTTCTGTTCATGTTTTTCAGG + Intergenic
1080488757 11:32739136-32739158 CAGTTCTGTTCTTTTTGTTCAGG + Intronic
1087106896 11:94418604-94418626 CAGTGCTGTCCATGATGTAATGG - Exonic
1088331123 11:108653114-108653136 CAGTTCTGTTCATTTTGCTCAGG - Intergenic
1088715493 11:112545574-112545596 CAGTCATGTTCAGGTTGTACAGG - Intergenic
1089737444 11:120559584-120559606 ATGTTCTGTGCATGTTGTTTTGG - Intronic
1091296705 11:134478767-134478789 CTGTCCTGTGCATGTTGGCCAGG + Intergenic
1091413394 12:258826-258848 CAAATGTGTGCATGTTGTAGGGG - Intronic
1094051844 12:26228612-26228634 CAGTTCTCTGCTGGCTGTACTGG + Intronic
1095255896 12:40035947-40035969 CAGTACTGTGAATTTTGTGCAGG - Intronic
1096376686 12:51117880-51117902 CAGTGCTGAGCATCTTGTAAAGG - Intronic
1103004996 12:117414012-117414034 CAGTGCTGTGCTTGAAGTACAGG - Intronic
1105742438 13:23341690-23341712 CATTTCTGTGTATGATTTACAGG - Exonic
1106551646 13:30776746-30776768 CCATTCTGTGCATGTTGTTTTGG + Intergenic
1106891384 13:34249517-34249539 GAGTTCTGTCCATGTCATACGGG - Intergenic
1108635026 13:52324847-52324869 AAGTTCTCTGCATGTTGGAGTGG - Intergenic
1108652778 13:52498345-52498367 AAGTTCTCTGCATGTTGGAGTGG + Intergenic
1109110011 13:58305012-58305034 CAGTACTGTACTTGCTGTACAGG - Intergenic
1109211594 13:59541432-59541454 CAGTACAGTACATGCTGTACAGG - Intergenic
1109380382 13:61551698-61551720 CAGTTTTGTTCTTGTTGTCCAGG + Intergenic
1110105401 13:71668897-71668919 GAGTTTTGTTCTTGTTGTACAGG - Intronic
1114286047 14:21244792-21244814 CAGTACTGTGCATGCTATGCAGG - Intronic
1114419210 14:22566358-22566380 GAGTTTTGTGCTTGTTGTCCAGG + Intronic
1116918655 14:50549438-50549460 CAGTCCTGTGGAGGTTGTATGGG - Intronic
1117164274 14:53018120-53018142 CTGTGCCGTGCATGTTATACTGG + Intergenic
1119544795 14:75463816-75463838 CCATTCTGTGCCTGTTGTCCTGG + Intronic
1121119452 14:91366986-91367008 CCGTTCTGTGCATGTGGCAGAGG + Intronic
1121681084 14:95793138-95793160 CACCACTGTGCATGTTGTACAGG - Intergenic
1123174381 14:106402461-106402483 CAGGTCTGTGCGTCTTGTTCTGG + Intergenic
1123182595 14:106483396-106483418 CAGGTCTGTGCGTCTTGTTCTGG + Intergenic
1202944308 14_KI270726v1_random:13333-13355 CAGGTCTGTGCGTCTTGTTCTGG - Intergenic
1125253261 15:37731172-37731194 CTGTTCTCTGCAATTTGTACCGG - Intergenic
1126192919 15:45897743-45897765 CTGTTTTGTGCCTGTTGTCCTGG + Intergenic
1127598080 15:60507029-60507051 CAGTTTTGTGCTTGGTGTATTGG + Intronic
1129040205 15:72679337-72679359 CAGTTTTGTGCTTGTTGCCCAGG - Intronic
1136644371 16:31597517-31597539 CACTTCTTTGCATGTTTTAGTGG + Intergenic
1141874005 16:86809119-86809141 AAGTACTGTGCATGTTTTCCTGG + Intergenic
1144150815 17:12441938-12441960 CAGTTTTGTTCATTTTGTTCAGG - Intergenic
1146987549 17:37235099-37235121 CAGTTCTTTTCATGGTGTGCAGG - Exonic
1152522264 17:80863409-80863431 CAGTTCTGAGCAGGTTTTAATGG - Intronic
1157065657 18:44347282-44347304 CAGTTCTGTGCAGGATGTGCAGG + Intergenic
1158255245 18:55539141-55539163 CAGTTCTGTGTTTTTTGTTCTGG - Intronic
1158689880 18:59650745-59650767 CACTGCCTTGCATGTTGTACTGG + Intronic
1161484711 19:4529127-4529149 CCATGCTGTGGATGTTGTACTGG - Exonic
1168277959 19:55287430-55287452 CAGTTCCTTGCCTGTTGCACAGG + Intronic
1168697067 19:58409483-58409505 CAGTTTTGTGCCTGTTGAGCAGG + Intronic
925430484 2:3787749-3787771 CACTTTTGTGCATGTTCTTCAGG + Intronic
925579705 2:5398128-5398150 CATTTCTTTGCATGATGTCCTGG - Intergenic
925900923 2:8508913-8508935 CAGTTCTGTGCATCTGGTGGTGG - Intergenic
927412459 2:22843028-22843050 CAGTTCTGTGAATGTATTCCTGG + Intergenic
929072574 2:38048549-38048571 CAGTTCTGGGCCTGCTGTACAGG - Intronic
932083192 2:68733841-68733863 CTGTTCTGAGCACTTTGTACTGG + Intronic
937814922 2:126240670-126240692 CAGTTCTGTGCATTTTGCACTGG - Intergenic
940417532 2:153439986-153440008 TAGTTCTGTGCAGGATGTGCAGG + Intergenic
941260482 2:163291113-163291135 CAGGTGTGTGTATGTTGTAGGGG + Intergenic
944140333 2:196449193-196449215 TAGTTCTGTGCATAATGTACTGG - Intronic
944329541 2:198449064-198449086 CATGTCTGTGCATGTATTACAGG - Intronic
944515876 2:200511032-200511054 AAGTTTTCTGCATGTTGTACTGG - Intronic
945246973 2:207727739-207727761 CTGTTCTGTGCCTGTTTTCCTGG + Intronic
945578279 2:211559442-211559464 CTTTTCTGTGCCTGTTGTCCTGG + Intronic
1169370294 20:5023737-5023759 CAGGTTTCTCCATGTTGTACGGG + Intergenic
1169390913 20:5190248-5190270 CAGTTCTGTTCCTGTTCTCCTGG - Exonic
1177105602 21:16951587-16951609 CAGTTTTGTTCCTTTTGTACAGG - Intergenic
1179194013 21:39148545-39148567 CATGTCTATGCATATTGTACTGG - Intergenic
1179275169 21:39885500-39885522 CAGTTCTGGGCATGTGGTTGAGG + Intronic
1180203978 21:46245502-46245524 CATTTCTGTGCATGGTGAAGGGG - Intronic
1181547522 22:23610516-23610538 CTGTTCTGTCCATGTGCTACTGG + Intronic
1182329666 22:29542244-29542266 GATTTCTGGGCATGTTGTATGGG - Intronic
1184479344 22:44737788-44737810 CAGACCTGTGCCTGTTGTCCAGG + Intronic
1184713838 22:46269036-46269058 CACATCTGTGCACTTTGTACTGG + Intronic
952685759 3:36146586-36146608 GCCTTCTGTGCATGTTCTACTGG - Intergenic
953272321 3:41457705-41457727 CCTTTGTGTGCATCTTGTACAGG + Intronic
957881151 3:86214453-86214475 CAGCTCAGTGCATGTTTTATGGG - Intergenic
961301424 3:125924537-125924559 CAGAGCTGTGCCTGTTGTCCTGG + Intergenic
961562527 3:127740581-127740603 CAGTTCTGTGGGGGTTGTGCAGG + Intronic
962856346 3:139349184-139349206 CAGTGCTGTGCATGTTGGTTGGG + Intronic
962898511 3:139736956-139736978 AAGTTCTGTGCCTGGTGTAGTGG + Intergenic
962911710 3:139857727-139857749 CATTTCTGTTTATGTTGAACTGG + Intergenic
962921045 3:139950902-139950924 CAGATCTGTGTGTGTTGTATTGG + Intronic
963223679 3:142838544-142838566 CAGGGTTCTGCATGTTGTACAGG - Intronic
965460395 3:168954837-168954859 CACTTCTCTGCAGGCTGTACAGG - Intergenic
967197532 3:187041595-187041617 CAGTTCTGTGCATGTTGTACTGG + Intronic
970713380 4:18890619-18890641 CAGTACAGTACATGTTGCACTGG - Intergenic
971581998 4:28353483-28353505 CAGTTTAGTGCATGTGGTAGTGG - Intergenic
974158152 4:58101560-58101582 CACTTCTGTGAATGTTTTAGAGG - Intergenic
974188279 4:58468114-58468136 CAGTTCTGTATATTTTGTAATGG + Intergenic
975487741 4:74952686-74952708 CAGTTCTGTGTAAGTATTACTGG + Intronic
980597933 4:134979743-134979765 AAGTCCTGTGTATGTTGTTCAGG - Intergenic
980651966 4:135728228-135728250 CATTTCTGTGAATTTTGTAAGGG - Intergenic
981574519 4:146190783-146190805 CAATTGTGTGAATGTTGTATTGG + Intronic
982468264 4:155758230-155758252 AAAGTCTGTGCATTTTGTACTGG + Intergenic
983206211 4:164912636-164912658 CACTTTTGTCCATGTTGAACAGG - Intergenic
984776997 4:183490487-183490509 GATTTCTATGCATGTTGTAAAGG - Intergenic
986079416 5:4374813-4374835 CGGTTCTGTGGTTGTTGTAAAGG - Intergenic
988205719 5:28130944-28130966 CAGTTATTTGAATTTTGTACTGG + Intergenic
991483456 5:67108797-67108819 CAGTTCTTTTCATGGGGTACGGG + Intronic
992466113 5:77006800-77006822 CATTTCTGTGCATATTTTAGTGG + Intergenic
993360903 5:86975130-86975152 CAGATGTGTGGAGGTTGTACTGG + Intergenic
994456419 5:100013609-100013631 GATGTCTGTGCATGTTGTTCCGG - Intergenic
995949088 5:117688043-117688065 TATTACTGTGCATGTTGCACAGG + Intergenic
998489691 5:142535779-142535801 CAGTACAGTACATGCTGTACAGG - Intergenic
999630400 5:153564843-153564865 CAGATCTGTGTATTTTGTATGGG + Intronic
1005382067 6:25245843-25245865 CAGTTTTCTGATTGTTGTACAGG + Intergenic
1007107457 6:39293655-39293677 CAGTGCAGTCCATGTTGTGCTGG - Intergenic
1015014269 6:128391483-128391505 AAGTTCTGTGCATGTAGTATTGG - Intronic
1015503339 6:133955096-133955118 CAGTTCTGTGAAGGATATACTGG + Intronic
1017748249 6:157466296-157466318 CAGCTCGGTGCGTGCTGTACAGG + Intronic
1018352308 6:162972624-162972646 GAGTGCTGTGCATGTGGAACTGG - Intronic
1018932069 6:168247159-168247181 CAATTGTGTGCATATTTTACAGG - Intergenic
1022336325 7:29425260-29425282 CAGCTCTGGGCATCTTGCACAGG - Intronic
1026960122 7:74402489-74402511 CAGTTTTGTGCTTGTTGCCCAGG - Intronic
1027364584 7:77444255-77444277 CACTTCTGTGCCTGTTGTTGAGG + Intergenic
1027987187 7:85308364-85308386 CAGCTCTGCACATGTTCTACAGG + Intergenic
1029244910 7:99192088-99192110 CAGTTCTGTTCATGGGGAACAGG - Intronic
1031722291 7:125192233-125192255 CAGTTTTGTTCATTTTGCACAGG - Intergenic
1036529949 8:9575906-9575928 CAGTTCTGTGAACGTAGTAAGGG + Intronic
1037317691 8:17614506-17614528 CAGTTCCTTGCATGTGGTAGAGG + Intronic
1038112072 8:24510937-24510959 CACTTCTGTGCATGTCGCAGGGG - Intronic
1038295689 8:26289567-26289589 AAGTTTTGTACCTGTTGTACAGG + Intergenic
1038633143 8:29264072-29264094 CAGATTTGTGCATGCAGTACTGG + Intergenic
1040864725 8:52037530-52037552 CAGTACAGTCCATGCTGTACAGG + Intergenic
1041809963 8:61896949-61896971 AAGCTTTGTGCATGTTGAACTGG - Intergenic
1043505256 8:80896034-80896056 CATTTCTGCCCATGTTCTACTGG + Intergenic
1044752541 8:95430249-95430271 CACTTCTGTGCATATTCTGCTGG + Intergenic
1045418409 8:101990209-101990231 CTGTTCTGTGCACTTTTTACAGG - Intronic
1045965801 8:108022897-108022919 CAGTTTTGTTCTTGTTGTCCAGG - Intronic
1046701897 8:117410300-117410322 CAGTAATTTTCATGTTGTACAGG + Intergenic
1052862436 9:33445357-33445379 CGGGTCAGTGCCTGTTGTACTGG + Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1057306781 9:93916894-93916916 CAGCTCTTTGCATTTTGTAGGGG + Intergenic
1058397657 9:104573571-104573593 CAGTTGTGTGAATTTTGTAGGGG - Intergenic
1187350594 X:18512102-18512124 CAGTTGTAAGCATGTTTTACTGG + Intronic
1189288657 X:39869919-39869941 CAGTACAGTACATGCTGTACAGG + Intergenic
1190022042 X:46887646-46887668 CAGTCCTGTACATGTTTTATTGG - Exonic
1194327406 X:92536846-92536868 CAGGGCTGTGCATGTTGCCCAGG + Intronic
1194371976 X:93084964-93084986 CAGTTTTGTTCATTTTGTTCAGG + Intergenic
1197121335 X:122896803-122896825 CAGTTTAGTTCATGATGTACAGG + Intergenic
1197202642 X:123761666-123761688 CTCTTCTGTGCATATTCTACTGG + Intergenic
1199111717 X:143943106-143943128 CAGTTCTGTGAATGTCTTACTGG + Intergenic
1199927725 X:152486022-152486044 CAGTTCTCTACATGTTGTGTGGG - Intergenic
1199993384 X:153003004-153003026 CAGTGTTCTGCAGGTTGTACAGG + Intergenic
1200636122 Y:5656071-5656093 CAGGGCTGTGCATGTTGCCCAGG + Intronic
1200680021 Y:6199001-6199023 CAGTTTTGTTCATTTTGTTCAGG + Intergenic