ID: 967201293

View in Genome Browser
Species Human (GRCh38)
Location 3:187074689-187074711
Sequence ATTTGGCAGAGGAAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 550}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967201282_967201293 21 Left 967201282 3:187074645-187074667 CCTCATGGAGGAAGTAGTGTTCG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG 0: 1
1: 0
2: 1
3: 37
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967201293 Original CRISPR ATTTGGCAGAGGAAGATGGA GGG Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
900751517 1:4400850-4400872 ACATGGCAGAGAAAGAGGGATGG - Intergenic
901384006 1:8894962-8894984 CTTTGGCAGGCCAAGATGGATGG - Intergenic
902195466 1:14794891-14794913 AGCAGGCAGAGGAACATGGAAGG + Intronic
902377729 1:16037726-16037748 AGTTGGATGTGGAAGATGGAGGG + Intergenic
903221541 1:21872376-21872398 ATCTGGCAGGGGAAAAAGGAGGG + Exonic
903780471 1:25817091-25817113 GCCTGGCAGAGGAAGAAGGAAGG + Exonic
904199441 1:28810495-28810517 AATTGGGATAGGAAGAAGGAGGG - Intergenic
904363165 1:29991624-29991646 TTTTCCCAGAGGAAGAGGGAAGG + Intergenic
906758276 1:48343528-48343550 ATTTGCCAGAGAGAGAGGGAAGG + Intronic
906865002 1:49408585-49408607 AGCAGGCAGAGGAACATGGAAGG + Intronic
907934847 1:59032941-59032963 ATGATGCAGAGGAGGATGGAGGG - Intergenic
908381064 1:63597157-63597179 ACTTGGGAGGGGAAGATGAAGGG + Intronic
908408304 1:63836812-63836834 AATTGGGAGACAAAGATGGAGGG - Intronic
908524114 1:64970995-64971017 CTTTTGCAGAGGAAGACTGATGG - Intergenic
909858604 1:80574479-80574501 AGCAGGCAGAGGAACATGGAAGG - Intergenic
910084144 1:83378766-83378788 ATTTGGCGTAGGAAGATTAAAGG + Intergenic
910105274 1:83625338-83625360 GCCTGGCAGAGGAAGATGGGTGG + Intergenic
910208986 1:84774967-84774989 ATGAAGGAGAGGAAGATGGATGG - Intergenic
910304108 1:85741958-85741980 GTTTGCCAGAGGAGGAGGGAGGG - Intronic
911263063 1:95710254-95710276 AGCAGGCAGAGGAACATGGAAGG - Intergenic
911307387 1:96247498-96247520 AGCAGGCAGAGGAACATGGAAGG + Intergenic
911642976 1:100308440-100308462 AGCAGGCAGAGGAAGTTGGAAGG - Intergenic
912559383 1:110539078-110539100 TTTTGGCAGATGGAGATGGAGGG - Intergenic
913516027 1:119606398-119606420 GATTGGCAGAAGAAGATAGAAGG - Intergenic
914307276 1:146432385-146432407 ATTTGACAGAGAAAGGAGGAAGG - Intergenic
914594830 1:149140746-149140768 ATTTGACAGAGAAAGGAGGAAGG + Intergenic
914849334 1:151302505-151302527 CCTTGGTAGAGGAATATGGAGGG - Intronic
915042089 1:152977114-152977136 GATTGGCAGAGGAGGATGGAAGG + Intergenic
915080820 1:153350549-153350571 ATTTGTCAGATAAAGAAGGAAGG + Intergenic
915597011 1:156901721-156901743 ATGAGGCAGAGGCATATGGAGGG + Intronic
917209039 1:172612739-172612761 CTTTGGTAGAGAAAGATGGGTGG - Intergenic
917263248 1:173192153-173192175 AATGGGCAGAGACAGATGGAGGG - Intronic
917513267 1:175685757-175685779 ATTTTGCAGAGGGAGATGTTTGG - Intronic
917741867 1:177968961-177968983 AATGGGCAGAGGAACCTGGAAGG - Intronic
918523221 1:185437871-185437893 ACTTGGGAGAGGAAGAAGGAGGG + Intergenic
918547155 1:185697880-185697902 TTTTGGGAGACGAAGATGGGAGG - Intergenic
918895448 1:190337481-190337503 AGCAGGCAGAGGAACATGGAAGG + Intronic
919113122 1:193244683-193244705 ATTTGGGAGAGGAAGATTTTAGG - Intronic
919848101 1:201654340-201654362 ATTGGGCAGAGAAAGTGGGAAGG - Intronic
920013996 1:202891056-202891078 ATTTGGGAGGGAAAGATGTAGGG - Intergenic
920089349 1:203441286-203441308 ATTTGGCAGAGGATGACACAGGG - Intergenic
920258503 1:204673064-204673086 ATCTGACAGAGGGAGAGGGAGGG - Intronic
920545605 1:206814371-206814393 ATTCTGCAGAGGATAATGGAGGG + Intronic
921025357 1:211274522-211274544 ATTTGCCAGAGGAATACTGAAGG - Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921509781 1:216014120-216014142 ATGTGGCAGAGAAAGTTGCACGG + Intronic
922072531 1:222209915-222209937 TTTTGGGAGAAGGAGATGGAAGG + Intergenic
922388064 1:225108105-225108127 AACTGGCAGAGGAACGTGGAAGG + Intronic
923172220 1:231428574-231428596 ATATGGCAGAAGGAGGTGGAAGG + Intergenic
924315643 1:242792606-242792628 ATTAGGGAGCGGAAGGTGGAAGG - Intergenic
924594311 1:245431897-245431919 ACATGGCAGAGGAAGAGGGCAGG - Intronic
924632256 1:245752199-245752221 ATCTGGCAAAGGAAGATGAATGG + Intronic
924650063 1:245917811-245917833 CTTTGGCAGAGCAAGAAGGCAGG + Intronic
924659430 1:246002856-246002878 CTTTGGGAGAGGGAGGTGGAAGG - Intronic
924944380 1:248836544-248836566 AATTGTAACAGGAAGATGGAGGG - Intergenic
1062976742 10:1689284-1689306 ATTAGGCACAGGAAGATTGTAGG + Intronic
1063039766 10:2325225-2325247 AGCAGGCAGAGGAAGGTGGACGG + Intergenic
1063175297 10:3545192-3545214 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063540302 10:6926903-6926925 ATAAGGCAGAAGCAGATGGAAGG - Intergenic
1064668280 10:17680648-17680670 CTTTGGGAGATGAAGGTGGAAGG - Intronic
1065113673 10:22463883-22463905 ATTGGCTAGAGGGAGATGGAAGG + Intergenic
1066045703 10:31593914-31593936 ACTAGGCAGATGAAGATGAATGG + Intergenic
1067805814 10:49392407-49392429 AATTTGGACAGGAAGATGGAAGG - Intronic
1068271076 10:54725431-54725453 ATTTGGGAGACCAAGGTGGAAGG + Intronic
1069119932 10:64556924-64556946 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1069190230 10:65478099-65478121 GGTTGGCAGAGGAAGATCGTAGG + Intergenic
1070093329 10:73311306-73311328 GTTTGCCATAAGAAGATGGAGGG - Intronic
1071374308 10:84987001-84987023 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1073631976 10:105158431-105158453 ATCTGGCTGAAGAAGGTGGAGGG + Intronic
1073704504 10:105967874-105967896 ATTTGTCAGAGAAATAAGGAAGG - Intergenic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073806632 10:107105659-107105681 AGCAGGCAGAGGAATATGGAAGG - Intronic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075585942 10:123658333-123658355 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1075847242 10:125554932-125554954 AATGGACAAAGGAAGATGGAAGG - Intergenic
1076444235 10:130500855-130500877 ATTTGGAAATGGAAGATGGAAGG + Intergenic
1076510320 10:131009014-131009036 AGCAGGCAGAAGAAGATGGAAGG - Intergenic
1077310768 11:1888167-1888189 GTTTGGCAGGGGAAGATGGTAGG - Intronic
1078131960 11:8620624-8620646 ATAGGGCAGAGGGAGAGGGAAGG - Intronic
1079357803 11:19744367-19744389 ATTTAGGACAGGGAGATGGAAGG - Intronic
1079368654 11:19831292-19831314 ATTTGGAAGAACAGGATGGAGGG + Intronic
1079480751 11:20877088-20877110 ATTGGGCAGGGAAAAATGGATGG + Intronic
1081351212 11:42054590-42054612 TTTTGGCAGAGCAAGATGACTGG - Intergenic
1081600659 11:44490842-44490864 ATTTGGCAGGCTGAGATGGAAGG + Intergenic
1082016782 11:47494993-47495015 ATTTGGCAGGCTGAGATGGAAGG - Intronic
1083213467 11:61203880-61203902 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083216349 11:61222716-61222738 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083219231 11:61241542-61241564 ATCTAAGAGAGGAAGATGGAAGG - Intronic
1083826909 11:65209183-65209205 ATCTGGCAGAGGAAGTGGGCAGG - Intronic
1084274293 11:68043806-68043828 ACGTGGCAGTGGAAGCTGGAGGG - Exonic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086894059 11:92291854-92291876 GTTGGCCAGAGGAACATGGAAGG - Intergenic
1087398385 11:97632718-97632740 ATTTGGGAGGTGAAGATGGGAGG - Intergenic
1087812454 11:102623121-102623143 ATTTTGGAGAGGAAGAAGTAAGG + Intronic
1088007497 11:104960711-104960733 ATTTGGGAGACCAAGATGGGTGG - Intronic
1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG + Intergenic
1088102620 11:106171855-106171877 AGCTGGCAGAGGAACATGGAAGG + Intergenic
1088600110 11:111466580-111466602 ATATAGCACAGGAGGATGGATGG + Intergenic
1089279580 11:117364007-117364029 CTTTGGGAGACCAAGATGGAAGG - Intronic
1089461673 11:118657671-118657693 AGTTGGGAGAGGAAGCTAGAAGG + Exonic
1089997807 11:122925636-122925658 ATTTGGGAGACCAAGATGGGTGG + Intronic
1090381454 11:126330493-126330515 ATTTGGCAGATGAAGAAGTAGGG + Intronic
1090479202 11:127053183-127053205 ACCTGGCAGAGGATGAGGGAGGG + Intergenic
1090807348 11:130210660-130210682 CTTTGTCAGAGGAAGATGGGCGG + Intergenic
1091016361 11:132054536-132054558 GTTAGGGAGAGGCAGATGGATGG + Intronic
1091303187 11:134520878-134520900 GATTGACAGAGGCAGATGGATGG - Intergenic
1091446811 12:548360-548382 ATTTGGCAGGGGAGGAGGGGAGG + Intronic
1092276165 12:7062388-7062410 ATTTGCCAGAGGCAGAAGAAAGG - Intronic
1092575538 12:9778527-9778549 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1092677678 12:10940819-10940841 AGATGGCAGAGAAAGATGTAAGG + Intronic
1093090205 12:14912023-14912045 ATTTGGAAGACTATGATGGAAGG - Intergenic
1093844452 12:23951341-23951363 AATTGGGAGGGGAAGTTGGAAGG - Intergenic
1094350174 12:29515520-29515542 GTTAGGCAGAGGAAGAAGCAAGG - Intronic
1096107280 12:49003727-49003749 ATTGGGCAGAAGGAGAGGGAGGG - Intronic
1096236279 12:49929462-49929484 ATGTGGCAGAGGAAGACTGGTGG - Intergenic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1096814938 12:54196044-54196066 ATTTTGAAGAGGGAGCTGGAGGG - Intergenic
1096923938 12:55121014-55121036 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1097248798 12:57621148-57621170 ATTGGGCCGGGGAAGAGGGAGGG + Intronic
1097279273 12:57834529-57834551 ATGGGGCAGAGGAGGAAGGAGGG + Intronic
1097585751 12:61514196-61514218 ATTTTGAAGAGCAAGATGAATGG - Intergenic
1098807569 12:75038762-75038784 TTTTGGCAGTGGAAATTGGATGG + Intergenic
1099120529 12:78684500-78684522 TTTTAGCAGATGAACATGGAAGG + Intergenic
1099387981 12:82041222-82041244 ATTTTGCAGAGGAACATTTATGG - Intergenic
1100074625 12:90765082-90765104 AACAGGCAGAGGAACATGGAAGG + Intergenic
1100382377 12:94073760-94073782 ATGTGGCAGAGGAAGAGGGCAGG + Intergenic
1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG + Intronic
1100756022 12:97751628-97751650 ACTAGGCAGAAGAACATGGAAGG + Intergenic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1102700177 12:114832272-114832294 ATTAGGCTGAGGACCATGGATGG - Intergenic
1103291948 12:119853941-119853963 CTTTGGGAGGGGGAGATGGAAGG + Intronic
1103707860 12:122888920-122888942 ATTAGGCAGAGCATGAGGGATGG - Intronic
1105289789 13:19045467-19045489 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1106716230 13:32391308-32391330 ATTGGGCAGAAGAAGAAGAAAGG + Intronic
1106989887 13:35406274-35406296 ATTTGGCTGAGGTCAATGGAAGG - Intronic
1107104436 13:36627942-36627964 ATTTGTCAGAGGAGGTTGGTAGG - Intergenic
1107784554 13:43941965-43941987 ATTAGGCAGAGGAAGAAGTAGGG - Intergenic
1107945303 13:45412714-45412736 TTATGGAAAAGGAAGATGGAGGG - Intronic
1108455516 13:50609840-50609862 AGGTGGCAGAGGAGGAGGGATGG - Intronic
1108824688 13:54398215-54398237 ATTTGGTAGAGGCAGAGGCATGG + Intergenic
1108866207 13:54925504-54925526 ATTTGGGAGAGGAACCTGGTGGG + Intergenic
1109048208 13:57440309-57440331 AGCTGGCAGAGGAACAAGGAAGG + Intergenic
1109241822 13:59898963-59898985 AGTAGGCAGAGGAACATGGAAGG + Intronic
1109432407 13:62252616-62252638 ACTAGGCAGAGAAAGAAGGAGGG - Intergenic
1109825113 13:67708961-67708983 ATATGGCAGAGAAAGGTGGAAGG + Intergenic
1110254118 13:73413058-73413080 ATTTGGGAGAGCAAGGTGGGAGG - Intergenic
1110363062 13:74649896-74649918 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1110505477 13:76280913-76280935 ATTTGGCAGAGGAAGATGTTGGG - Intergenic
1111212740 13:85100968-85100990 ATTTGGGAGGGCAAGATGGGTGG + Intergenic
1111471353 13:88686593-88686615 ATTGGGCAGAAGAAGCTGGTTGG + Intergenic
1111679562 13:91426708-91426730 AGCAGGCAGAGGAATATGGAAGG - Intronic
1111741504 13:92211344-92211366 ATGAGGAAGAGCAAGATGGATGG - Intronic
1111858016 13:93664460-93664482 ATTTGGCAAATGTAGATGGATGG + Intronic
1112159961 13:96856771-96856793 ATTTCAGAGTGGAAGATGGAGGG - Intergenic
1112207306 13:97337448-97337470 ATATGGAAGAGGAAAATGGTGGG - Intronic
1114038497 14:18653096-18653118 AGCAGGCAGAGGAATATGGAAGG - Intergenic
1114347153 14:21808166-21808188 ATGTCGCAGAGGAAGAAGAATGG - Intergenic
1114479259 14:23021751-23021773 ACGTGGCAGAGAAAGATGGATGG - Intronic
1114561002 14:23590407-23590429 CTTTGGGAGATGAAGGTGGAAGG + Intergenic
1115183017 14:30652053-30652075 ATTTACCAGAGCTAGATGGAAGG - Intronic
1115718291 14:36130217-36130239 AACTGACAGAGGAAGATAGATGG + Intergenic
1115876249 14:37865125-37865147 ACTTGGCAGAGGAGGAGAGAGGG - Intronic
1116645024 14:47516375-47516397 ATTTGGCAGAGGAATATCTGGGG - Intronic
1117470799 14:56042693-56042715 ACTGGGCAGAGGGAGATGAACGG + Intergenic
1118389365 14:65283283-65283305 AGTGGGCACAGAAAGATGGAAGG - Intergenic
1118440256 14:65805667-65805689 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1119226332 14:72947197-72947219 CTTTGGCAGAGGAAGAGGTTTGG + Intronic
1119319999 14:73724931-73724953 ATTCCCCAGAGGAAGATGCAGGG - Intronic
1119416771 14:74476165-74476187 TTGTGGCAGAGGCATATGGATGG + Intergenic
1120859175 14:89239288-89239310 AATTAACAAAGGAAGATGGATGG - Intronic
1121053761 14:90836685-90836707 ATTTTGGAGAGGAAGAGAGAAGG - Intergenic
1121082520 14:91119808-91119830 AGCAGGCAGAGGAACATGGAAGG + Intronic
1121631229 14:95423167-95423189 ATTTTGGAGAGGGAGAGGGATGG + Intronic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1121774745 14:96583220-96583242 ACCTGGCAGGGGCAGATGGAGGG - Intergenic
1122319070 14:100842531-100842553 ATTTGTCAGGGGAAGTTGTAAGG + Intergenic
1202860549 14_GL000225v1_random:79015-79037 ATGTGGCAGGGGCAGATGCAAGG - Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124700820 15:31910239-31910261 TGTGGGCAGAGGACGATGGAGGG + Intergenic
1124930735 15:34116864-34116886 AATGGGCAGAGGCAGATGGTTGG + Intergenic
1125969829 15:43902906-43902928 TTTTGGCAAAGGAAGAGGGCTGG - Intronic
1126134215 15:45375480-45375502 AAAGGGCACAGGAAGATGGATGG + Intronic
1126729312 15:51666002-51666024 GTTTGCCAGAGGATGATGGGAGG - Intergenic
1127246367 15:57179792-57179814 ATTTGGGGGAGGAAGAAGGGGGG - Intronic
1127362576 15:58257794-58257816 ATTTCCCAGAGGATGCTGGAGGG - Intronic
1128005297 15:64234001-64234023 ATTTGAGAGAGGAAGCGGGAGGG - Intronic
1128961100 15:72005628-72005650 ACCTGGCAGAGGAAGAGGCAGGG - Intronic
1129105872 15:73306905-73306927 AATTGGGAGAGGTTGATGGATGG - Intergenic
1129907754 15:79201402-79201424 GCTGGCCAGAGGAAGATGGAAGG - Intergenic
1130081814 15:80740438-80740460 ATTTGCCAGAGGGAGAAGGCAGG - Intronic
1130723241 15:86410775-86410797 ATTTTGCAGAGGAAGAGACAAGG + Intronic
1131701280 15:94938757-94938779 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1131819649 15:96259116-96259138 ATTTAGCAGGGTAAAATGGATGG + Intergenic
1133532689 16:6670311-6670333 TTTTGGGAGACCAAGATGGAAGG - Intronic
1133614071 16:7459394-7459416 ATTTGCCAGAGAAGGAAGGAAGG - Intronic
1134067251 16:11236769-11236791 ATTTGGCAGAGGCAGGAGGGAGG + Intergenic
1134411302 16:14004736-14004758 ATTTGGAAGAGGAAGCTTCAGGG + Intergenic
1134431626 16:14214085-14214107 ATTTGGCGGAGGTGGATGGGAGG - Intronic
1134543992 16:15093832-15093854 ATTTGGACGAAGAAGAGGGAAGG + Intronic
1134702168 16:16274458-16274480 GTTTGGCAGAGCATGATGGGAGG + Intronic
1134839264 16:17388520-17388542 ATTTTGCAGAGGAAGAAGTTGGG - Intronic
1134969662 16:18520192-18520214 GTTTGGCAGAGCATGATGGGAGG - Intronic
1135361566 16:21819982-21820004 ATTTGGACGAAGAAGAGGGAAGG + Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135965640 16:27032773-27032795 ACTTGGCAAAGGGAGATGGATGG + Intergenic
1136050539 16:27646926-27646948 AGCTGGCAGAGGAAGCTGCAGGG + Intronic
1136260971 16:29075412-29075434 ATTTGGACGAAGAAGAGGGAAGG - Intergenic
1136945875 16:34650379-34650401 ATTTGGAAGACCAAGGTGGAAGG - Intergenic
1136956203 16:34789413-34789435 ATTTGGGAGGGCAAGGTGGAAGG - Intergenic
1137466275 16:48712733-48712755 ATGTGGCAGAAGAAGATTTATGG - Intergenic
1138781796 16:59797310-59797332 ATTATTCAGAGGAAGAAGGAAGG + Intergenic
1139018792 16:62723204-62723226 ATTTCATAGTGGAAGATGGAAGG + Intergenic
1139022546 16:62768345-62768367 ATGTGGCAGAGGAAGATGATAGG + Intergenic
1139334183 16:66219481-66219503 AGATGGCAGTGGATGATGGATGG - Intergenic
1139809954 16:69606221-69606243 ATATGGAAGGGGAAGATGGGAGG - Intronic
1141270118 16:82531910-82531932 ATGAGGGAGAGGCAGATGGAAGG - Intergenic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1143023398 17:3928073-3928095 ACCTGGCAGAGGCAGGTGGATGG + Intronic
1143277910 17:5727400-5727422 AACAGGCAGAGGAATATGGAAGG + Intergenic
1143464052 17:7123792-7123814 TGTAGGCAGAGGAACATGGAAGG + Intergenic
1143687370 17:8528868-8528890 ATTTGGCCTTGGTAGATGGATGG + Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1143967999 17:10770665-10770687 TTCTGGGTGAGGAAGATGGATGG + Intergenic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144221824 17:13106665-13106687 ATTTGGGAGGTGGAGATGGAAGG + Intergenic
1144408489 17:14975764-14975786 ATTTGGTATTGGGAGATGGATGG - Intergenic
1144543501 17:16169517-16169539 AATGGGGAGAGGGAGATGGAAGG + Intronic
1145296338 17:21595341-21595363 ATTTGTTTGAGGAAGATAGATGG + Intergenic
1145367446 17:22276726-22276748 ATTTGTTTGAGGAAGATAGATGG - Intergenic
1148398597 17:47332549-47332571 GTTTGGGGGAGGAAGAGGGATGG - Intronic
1148536408 17:48442669-48442691 ACTTGGCAGAGGAAGAAAGAGGG - Intergenic
1148579866 17:48736054-48736076 AGTTGGGAGAGGAAGAAGGCAGG + Intergenic
1148700128 17:49582121-49582143 CTTAGCCAGAGGAAGTTGGATGG - Intronic
1149187423 17:54016024-54016046 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1150146502 17:62773917-62773939 ATGAGGCAGAAGATGATGGATGG + Intronic
1150372164 17:64648888-64648910 ATTTTGTAGAGAAAGAAGGATGG - Intronic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1151477689 17:74353169-74353191 AGTTGGCAGAGGAAGATGAGTGG - Intronic
1152037998 17:77885120-77885142 ATTTGGCAGAAGGAGGTGGGTGG - Intergenic
1152268319 17:79309232-79309254 ATTTTGCACAGGAAGGAGGAAGG + Intronic
1153104097 18:1507985-1508007 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1153319556 18:3759239-3759261 TTTTGGCAGAGCAATATAGATGG - Intronic
1155581506 18:27313299-27313321 ATTTGGGATAGGGAGATGGGTGG + Intergenic
1155793666 18:30006178-30006200 ATATGGTAGAGGAATCTGGAGGG + Intergenic
1156071227 18:33212559-33212581 AATTGGCAGAGCAAGCTGCAGGG - Intronic
1156640741 18:39094270-39094292 ATTTTGCAGAAGAAAATAGAGGG - Intergenic
1156896568 18:42253540-42253562 AGGAGGCAGAGGAACATGGAAGG - Intergenic
1156980494 18:43281896-43281918 ATTTGGGAGGTGAAGATGGGAGG + Intergenic
1159481545 18:68996214-68996236 AGCAGGCAGAGGAACATGGAAGG + Intronic
1159683196 18:71381293-71381315 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1160281674 18:77496613-77496635 AATTTGCAGAGGAAGTAGGAAGG - Intergenic
1163190345 19:15672857-15672879 AGTTTGCAGGGGAAGTTGGAGGG - Exonic
1163241760 19:16067856-16067878 CTTTGGCGGAGGAAGAGCGAGGG + Intronic
1163995310 19:21040079-21040101 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1164001905 19:21108180-21108202 ATTTGGAAGATGAAGGTGGGAGG - Intronic
1168512460 19:56983827-56983849 ATTTGACGGTGGAAGATGGGAGG - Intergenic
925545882 2:5015559-5015581 ATTTGGCAAAGAAAGATACAGGG - Intergenic
925619034 2:5772614-5772636 CTTTGTCAGAGGAGGAGGGAAGG + Intergenic
925629963 2:5882061-5882083 CTTTTGCAGAGGAAGTTGCAGGG - Intergenic
925731733 2:6923866-6923888 ATTTAGCAGAGGAAATAGGATGG - Intronic
925900220 2:8503929-8503951 AGCAGGCAGAGGAACATGGAAGG + Intergenic
926841855 2:17089728-17089750 AGCAGGCAGAGGAAGATGGAAGG - Intergenic
927151937 2:20201205-20201227 AAATGGCAAAGGAAGGTGGATGG - Exonic
927882027 2:26695717-26695739 AAACGGCAGAGGAAGAGGGAAGG - Intronic
928809335 2:35203153-35203175 AGCAGGCAGAGGAACATGGAAGG - Intergenic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929592166 2:43154432-43154454 AAAAGGCAGAGGAGGATGGACGG + Intergenic
929603972 2:43222858-43222880 ATTTGGTTGAGGAAGATTTAAGG + Exonic
929920723 2:46169415-46169437 AGTAGCCAGAGGAACATGGAGGG - Intronic
929994560 2:46817274-46817296 TCTTGGTAGAGGAAGCTGGAGGG - Exonic
931165590 2:59744109-59744131 CTTTGGCCAAGGCAGATGGAGGG + Intergenic
931235561 2:60409966-60409988 ATTTTCCAGATGAAGAAGGAAGG + Intergenic
931956387 2:67430591-67430613 ATTTGGCAGAGCAGGATAGGAGG - Intergenic
932755649 2:74407436-74407458 ATTTGGGAGTGGAAGGTGGGAGG - Intergenic
932879524 2:75488197-75488219 TTTTGCCAGTGGAAGATGGCAGG - Intronic
932922288 2:75930110-75930132 AGTTGGCAAAGGAAGATAGTTGG + Intergenic
932948589 2:76266573-76266595 AGTTGGCAGTGGGAGATAGAAGG + Intergenic
933518212 2:83332637-83332659 TTTTGGTAGAAGAAGATAGAAGG + Intergenic
933851622 2:86371826-86371848 ATCTAGCAGAGGAGGAGGGAGGG - Intergenic
934784740 2:96996755-96996777 ATCAGGCAGTGGAATATGGAGGG - Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935214440 2:100965101-100965123 ATGGGGCAGATGAAGTTGGAGGG - Intronic
936061949 2:109300646-109300668 AGAAGGAAGAGGAAGATGGATGG - Intronic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
936814973 2:116449352-116449374 TTTTGGCAGAGAAAGAAGGCAGG + Intergenic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937397981 2:121555499-121555521 ATTTTGAGGAGGAGGATGGAGGG + Intronic
937422799 2:121772563-121772585 ACGTGGCAGAGGAAGCTGAAGGG - Intergenic
937697185 2:124821007-124821029 CTTTGTCAAAGGAAGTTGGAGGG + Intronic
937713068 2:125000168-125000190 ATGTGGTGGAGGAAGATGTATGG - Intergenic
939269526 2:139919828-139919850 ATTTAGCTGAGCAAGAAGGAAGG - Intergenic
939350879 2:141036341-141036363 ATTTACAAGAGAAAGATGGAAGG + Intronic
939362888 2:141196760-141196782 GTTTGGAACAGGAAGATGGTAGG - Intronic
939549825 2:143601063-143601085 GTTTGGCTGAAGAACATGGATGG + Intronic
940079389 2:149783136-149783158 AGTTGACAGAGAAAGAGGGAGGG - Intergenic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940624795 2:156160220-156160242 ATCTGGAAGAGGATGATGAAGGG + Intergenic
940692836 2:156940968-156940990 ATAGGGCAGAGGAAGATAAATGG - Intergenic
941487263 2:166097822-166097844 ATTTGGGAGACCAAGGTGGAAGG - Intronic
941640178 2:167978756-167978778 ATCAGGAAGAGGAAGATGGGAGG - Intronic
942061307 2:172230960-172230982 AGGTGGCAGAGGATGATGTATGG - Intergenic
942917306 2:181326775-181326797 ATGTGGCAGACCATGATGGAGGG + Intergenic
943179158 2:184521310-184521332 AAATGGAAGAGGAAGGTGGATGG + Intergenic
943593967 2:189832980-189833002 AGCTGGCAGAGGGAGATGGTTGG - Intronic
943721372 2:191206507-191206529 ATTTCCCCGAGGAAGCTGGAAGG - Intergenic
943903329 2:193469347-193469369 ATTAGGCAGATAAAGAAGGAGGG + Intergenic
944155240 2:196600774-196600796 GTTTGGGAGAGCAAGATGGGAGG + Intergenic
946941854 2:224777422-224777444 AGTAGGCAGAGGAATGTGGAAGG + Intronic
947314985 2:228847162-228847184 AGCAGGCAGAGGAAGTTGGAAGG + Intergenic
948020849 2:234732101-234732123 CTTTGGGAGAGCAAGGTGGACGG - Intergenic
1168751059 20:281733-281755 CTTTGGAAGAGCAAGGTGGAAGG + Intronic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169620351 20:7499535-7499557 ACTTGGGAAAGGCAGATGGAAGG + Intergenic
1169769769 20:9188195-9188217 ATTAGGCAGGGGAGGAAGGATGG + Intronic
1170054076 20:12179762-12179784 ATTTGGGAGAGAGAGGTGGAAGG - Intergenic
1170404105 20:16018549-16018571 ATTTTGGTGGGGAAGATGGAAGG - Intronic
1170406416 20:16042704-16042726 ACTTTGCAGAGCAGGATGGACGG + Intronic
1170427283 20:16247438-16247460 ATTGGGCAGAGGAAGGAGTAGGG + Intergenic
1170479813 20:16754618-16754640 AACAGGCAGAGGAACATGGAAGG + Intronic
1170518940 20:17163101-17163123 ATTTGTCATAGGAAGATGCTGGG - Intergenic
1172278993 20:33697535-33697557 ATTTGGGAGAGGAAGCTGTCAGG + Intergenic
1172468098 20:35172025-35172047 TCTGGGCAGAGGAGGATGGAAGG - Intergenic
1172791203 20:37506679-37506701 ATGGGGCAGAGGAAAATGAAAGG - Intronic
1174013688 20:47471016-47471038 ATTTGGCAGAGGCAGTTTCAAGG + Intergenic
1174699119 20:52590042-52590064 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1174788019 20:53450987-53451009 ATCTGGGAGAGGAAGATTCATGG - Intronic
1175829197 20:61952819-61952841 ATATGTAAGAGGGAGATGGAGGG - Intergenic
1177356075 21:20009459-20009481 ATTTGGCACTAGAAGAGGGAGGG - Intergenic
1177395043 21:20523277-20523299 GCTTGGCAGAAGAAGATGCATGG + Intergenic
1177737877 21:25115719-25115741 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1177816561 21:25984109-25984131 ATTAAGCAGAGGAGGAGGGAAGG - Intronic
1177904737 21:26961848-26961870 GTTTGGAAGAGGGAGAGGGATGG - Intronic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1180462621 22:15580138-15580160 AGCAGGCAGAGGAATATGGAAGG - Intergenic
1181390023 22:22573512-22573534 ATTTGGGAGGGAAAGAGGGAAGG + Intergenic
1183077646 22:35436901-35436923 AGTTCGCAGATGAGGATGGAAGG + Intergenic
1183733926 22:39633129-39633151 ATTGGAGAGAGGAAGATGGAAGG - Intronic
1184938788 22:47745344-47745366 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1185408437 22:50670918-50670940 ACCTGGGAGAGGAAGGTGGAGGG + Intergenic
950588971 3:13921676-13921698 AGCAGGCAGAGGAACATGGAGGG + Intergenic
952041001 3:29261756-29261778 ATTTGGGAGAAAAAAATGGATGG + Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952557245 3:34546671-34546693 TCTTGGCAAAGGCAGATGGAAGG - Intergenic
954462275 3:50634090-50634112 ATTTGGCAAAGGAGGATGAGGGG + Intronic
954505016 3:51061804-51061826 ATTTAGCAGAGGAAACTAGAAGG - Intronic
954595539 3:51820890-51820912 AGGTGGCAGAGGAAGAAGCAAGG - Intronic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
955056166 3:55457810-55457832 AATGGGAAGAGGAAAATGGAAGG - Intergenic
955192224 3:56772055-56772077 ATCTGGGAGAGCAAGATGAAGGG - Intronic
955878000 3:63513789-63513811 AATGAGGAGAGGAAGATGGAAGG + Intronic
957242357 3:77675226-77675248 AGCAGGCAGAGGAACATGGAGGG + Intergenic
957320116 3:78619598-78619620 ACCTGGCAGAGGCAGGTGGAGGG + Intronic
958061258 3:88484500-88484522 ATATGGGAGTGGAGGATGGATGG + Intergenic
958984772 3:100767550-100767572 ATTTGTTAGAAAAAGATGGAAGG + Intronic
959151984 3:102618743-102618765 ACTTGGCAGAGGGAGATGTTGGG - Intergenic
959181770 3:102989250-102989272 TTTTGGCAGGGCAAGATGGAAGG - Intergenic
959696787 3:109256714-109256736 CGTAGGCAGAGGAACATGGAAGG - Intergenic
959770725 3:110091962-110091984 ATTTTGCACAGAAAGATGGCAGG - Intergenic
959902889 3:111679849-111679871 ATTTGACAAGGGAAGAAGGAAGG - Intronic
960136397 3:114110029-114110051 ATCTGGGAGACCAAGATGGAGGG - Intergenic
960222748 3:115134146-115134168 AGTTGTCAGAGGAAAATTGATGG - Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
962428093 3:135292217-135292239 ATTTTGCAGATGAGCATGGAAGG + Intergenic
963505172 3:146175964-146175986 ATTTGGTAGATGAATATGTAGGG - Intergenic
964655679 3:159063910-159063932 ACTTGGAAGAGGAAGCTAGATGG - Intronic
965215885 3:165864365-165864387 ATTTGGCAAAGGAAAGTGAAGGG - Intergenic
966107224 3:176350783-176350805 AGTAGGCAGAGGAATGTGGAAGG - Intergenic
966282378 3:178247019-178247041 CCTTGGCAGAGAAAGATGGTAGG - Intergenic
966742210 3:183244216-183244238 AACAGGCAGAGGAAGGTGGAAGG + Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
969073541 4:4558846-4558868 ATGGGGCAGAGCAGGATGGAGGG - Intergenic
969367356 4:6704737-6704759 ATTTGGGAGAGGACCAGGGAGGG + Intergenic
969983830 4:11186719-11186741 AGAAGGCAGAGGAACATGGAAGG + Intergenic
970034619 4:11718919-11718941 AATTGTCAGAGGGAGATGAAAGG - Intergenic
970071595 4:12165548-12165570 ATCAGGCAGAGGAACACGGAAGG + Intergenic
970084654 4:12333191-12333213 AACAGGCAGAGGAGGATGGAAGG - Intergenic
972123938 4:35740428-35740450 AGTAGGCAGAGGAATGTGGAAGG + Intergenic
972698228 4:41468433-41468455 ATTTACCAAAGGAAGATAGAAGG - Intronic
973335356 4:48950317-48950339 TTTTGACAGATGCAGATGGATGG + Intergenic
973539827 4:51924762-51924784 AGTTGACAGAGGAAGATTCAGGG - Intergenic
973815725 4:54617223-54617245 ATTTTGCTGATGAAAATGGAAGG + Intergenic
973849301 4:54945520-54945542 ATCTGGCAGAGGAGGAGGGAGGG + Intergenic
974275139 4:59710116-59710138 ATAAGGCAGAGGAAGATTAATGG - Intergenic
974387609 4:61223034-61223056 ATTTAGAAGATGAAGATTGAAGG + Intronic
975386415 4:73764976-73764998 AGGTGGCAGATGAATATGGAAGG - Intergenic
975476697 4:74831732-74831754 AAGTGGGAGAGGAAGAGGGAAGG - Intergenic
976335139 4:83876926-83876948 ATTAGGCAGAGGAAGAAGGCAGG + Intergenic
977014460 4:91675827-91675849 ATAGGGCAGAGGAAGCAGGAAGG + Intergenic
977082006 4:92542202-92542224 ACTTGGGAGATGAAGATGGGAGG + Intronic
977997037 4:103506840-103506862 ATTTTGCAGAGAAGGATGAAAGG - Intergenic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
980268257 4:130548522-130548544 ATTTGGCAGAGAATGGAGGATGG - Intergenic
980322573 4:131297958-131297980 ATCAGGCAGAGAAACATGGAAGG + Intergenic
980482700 4:133408686-133408708 AGCAGGCAGAGGAACATGGAAGG + Intergenic
980681270 4:136165056-136165078 ATATGGAAGAAAAAGATGGATGG + Intergenic
980850116 4:138371114-138371136 ATTTGGAAGTGGAATAAGGAAGG + Intergenic
981331649 4:143515816-143515838 ACATGGCAGAGCAAGATGGGTGG - Intronic
981495349 4:145385652-145385674 ACATGCCAGAGGAAGACGGAAGG + Intergenic
983020075 4:162665361-162665383 AGCAGGCAGAGGAACATGGAAGG + Intergenic
983512352 4:168622212-168622234 ATTTGGCATAGGGAGGAGGATGG - Intronic
983605976 4:169584501-169584523 ACTTGGGAGACTAAGATGGAAGG + Intronic
983902223 4:173147684-173147706 AGTTGGTAAAGGAAGATGGTGGG - Intergenic
984021018 4:174484894-174484916 ATTTGGCACCAAAAGATGGAGGG + Intergenic
984784506 4:183555040-183555062 AATGAGCAGAGGAAGAGGGAGGG - Intergenic
985631887 5:1018145-1018167 TTCTGGCAGAGGGAGATGGGTGG - Intronic
987971072 5:24945305-24945327 ATTTGGCAGGGGAGGGTGGCGGG - Intergenic
988273607 5:29051391-29051413 ATTGGGGAGAGGAAGAAGCATGG - Intergenic
988329843 5:29821832-29821854 ATTTGGCTTAGGAAAATGGCTGG - Intergenic
988628747 5:32906323-32906345 ATTTTGAAGATAAAGATGGAAGG + Intergenic
988780661 5:34518776-34518798 ACTTGGGAGACTAAGATGGAAGG - Intergenic
988999258 5:36744152-36744174 TTGTGGGAGAGGGAGATGGAAGG - Intergenic
989204016 5:38793719-38793741 ATTAGCCAGATGAAGAAGGATGG - Intergenic
989338900 5:40352118-40352140 ATTTGGGAGAAGGAGATGGGAGG + Intergenic
989436482 5:41419106-41419128 ATTTGGCAGAGGCAGGGGGTGGG + Intronic
989537862 5:42584328-42584350 TTTTAGCAGAGGAACATGGCAGG + Intronic
990598562 5:57334699-57334721 CTTTGGTAGAGGAAGGTGGCTGG - Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
991011433 5:61886941-61886963 CTTTGGCAGAGGGAGATTGCTGG + Intergenic
991034027 5:62109663-62109685 AGCAGGCAGAGGAACATGGAAGG + Intergenic
991050388 5:62266649-62266671 CCTTGGCAGAGGAAGGTGGACGG + Intergenic
992319713 5:75601565-75601587 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
992788255 5:80190353-80190375 CTTTGGCAGACCAAGATGGGAGG - Intronic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
995287927 5:110413182-110413204 AGCAGGCAGAGGAACATGGAAGG + Intronic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995708244 5:115007692-115007714 CTTTGGAAGAGGAAGAAGGCAGG + Intergenic
997191583 5:131941874-131941896 ATTTGGCAAATGAAGAGTGAAGG - Intronic
997311784 5:132891888-132891910 ATTTGGGAGGCTAAGATGGAAGG - Intronic
998068596 5:139178994-139179016 ATTTGGGAGAGAAAGGGGGAAGG - Intronic
999010759 5:148036643-148036665 TTTTGGAAGAGCAATATGGAGGG - Intronic
999194432 5:149772379-149772401 ATTTGGCTGAGGAGGCTGCATGG + Intronic
1000349739 5:160343947-160343969 AGTTGGCAAGGGAAGCTGGATGG - Intronic
1000434094 5:161186230-161186252 ATTTGGAAGAGGCAGATAGATGG + Intergenic
1000448182 5:161350737-161350759 AGCAGGCAGAGGAACATGGAAGG + Intronic
1000574374 5:162958449-162958471 CTTTGGCAGAGTATGGTGGAGGG + Intergenic
1001069039 5:168568130-168568152 ATTTGACACAGGAACATGGCAGG + Intronic
1001266216 5:170276390-170276412 GTCTGGGAGGGGAAGATGGAAGG - Intronic
1001738146 5:174023810-174023832 GTTGGTCAGAGGAAGATGGTAGG - Intergenic
1003085650 6:3058845-3058867 ATTTGGGAGAGGGAGAGAGATGG - Intergenic
1003443794 6:6166734-6166756 ACTTGGCAGAGGAAGGCCGAGGG - Intronic
1003460378 6:6323012-6323034 AGATGGCAGAGGAAGATGATAGG - Intergenic
1004125962 6:12873761-12873783 AATGGGCAGAGGAGGATGTAAGG + Intronic
1004138037 6:12987785-12987807 ATTTGCTAGAATAAGATGGAAGG + Intronic
1004770300 6:18773651-18773673 ATTTGGCAGATGAAGAGGATGGG - Intergenic
1004880897 6:20007212-20007234 ATCTGGCAGAGGAAGTGGGGAGG - Intergenic
1005006602 6:21293424-21293446 AGTTGGGAGGGGAAGATGGGAGG - Intergenic
1005997097 6:30938218-30938240 ATCTGGGAGAGGAAGAAGGAAGG - Intergenic
1007092057 6:39190729-39190751 ATCTAGCTGAGGATGATGGAAGG + Exonic
1007294967 6:40814652-40814674 ATTAGAGAGAGGAAGTTGGAGGG - Intergenic
1007375939 6:41456779-41456801 AAGGGGCAGAGGGAGATGGAAGG - Intergenic
1009430076 6:63556422-63556444 CTTTGGCAGGCCAAGATGGAAGG - Intronic
1009981284 6:70728875-70728897 ATTAGGCAGAGCAAAAGGGAGGG - Intronic
1010629441 6:78179992-78180014 AGTAGGCAGAGGAACCTGGAAGG - Intergenic
1011645994 6:89458634-89458656 AGCTGGCAGGAGAAGATGGAAGG - Intronic
1011752341 6:90465798-90465820 AGTTGGCAAGAGAAGATGGAAGG - Intergenic
1012424179 6:99096040-99096062 AGCTGGGAGAGGAAGATGAAAGG + Intergenic
1012743277 6:103048326-103048348 CTTTGACAAAGAAAGATGGAAGG - Intergenic
1013225832 6:108118796-108118818 ATTTGGCAGAGGCAGAAGAGAGG + Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1013887499 6:114987994-114988016 AGCAGGCAGAGGAAGGTGGAAGG + Intergenic
1014426533 6:121313507-121313529 ATTTGGAAGAGGAATGTGTAGGG - Intronic
1014462785 6:121717739-121717761 ATTTCGTGGATGAAGATGGAGGG - Intergenic
1015029080 6:128572267-128572289 TTCAGGCAGAGGAAGATGTAGGG + Intergenic
1015526043 6:134175870-134175892 ACTTGGAAGAGGAGGAAGGAAGG + Intronic
1016214919 6:141587942-141587964 AATTTGCAGAGGAAGATGGCAGG - Intergenic
1016422482 6:143899853-143899875 ATTTGTCATTGAAAGATGGAGGG + Intronic
1016591536 6:145750584-145750606 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1017067177 6:150539834-150539856 ATTTTGCACAGGGAGATGAATGG + Intergenic
1017228281 6:152044729-152044751 AACAGGCAGAGGAACATGGAAGG - Intronic
1017357633 6:153528428-153528450 AGCTGGCAGAAGAAGGTGGAAGG - Intergenic
1017379883 6:153815616-153815638 ATCAGGCAGAGGAACTTGGAAGG - Intergenic
1017420910 6:154271738-154271760 GTTTGGAAGACCAAGATGGAAGG + Intronic
1017654802 6:156617434-156617456 AGTGAGCAGCGGAAGATGGATGG - Intergenic
1018007735 6:159638967-159638989 AGTTGGGAGAGGCAGAAGGAAGG + Intergenic
1019476410 7:1246770-1246792 ATTTGGGAGAGGAAGGAAGATGG + Intergenic
1020136665 7:5591842-5591864 CTTTGGGGGAGGAGGATGGAGGG + Intergenic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022327315 7:29344028-29344050 CTTGGGCAGAGGAAGATGAATGG - Intronic
1022732889 7:33047335-33047357 ATGTGGCACAGTAAGAAGGAAGG - Intronic
1022950608 7:35334499-35334521 ATTTAGCACAGCATGATGGATGG + Intergenic
1023621385 7:42076814-42076836 AATTGGTACAGGAGGATGGAAGG + Exonic
1024113604 7:46172134-46172156 ATTTGGCAGAGCGTGATGGCAGG - Intergenic
1026325668 7:69307074-69307096 CAGTGGCAGAGGAAGAGGGAGGG + Intergenic
1026448386 7:70505795-70505817 AGTTGGCAGAGAAACATGAAAGG - Intronic
1027440861 7:78217700-78217722 ATTTGCCATAGCAAGATGGCAGG + Intronic
1027455039 7:78379704-78379726 ATTGGAAAGAGAAAGATGGATGG - Intronic
1027929258 7:84510096-84510118 ATCAGGCAGAGGAAAGTGGATGG + Intergenic
1028264041 7:88701292-88701314 AATTGGGAGAGGAAGCTAGAAGG + Intergenic
1028396990 7:90380787-90380809 GCTTGGGGGAGGAAGATGGAGGG - Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1029505364 7:100960670-100960692 ATTTTGCAGGGGAGGAAGGAGGG - Intronic
1030149716 7:106391580-106391602 CTTTGGCAGAGCAAGATAGGAGG - Intergenic
1030341388 7:108384532-108384554 ATTTGGCAGAGGAGATTTGAAGG + Intronic
1030360640 7:108591500-108591522 ATTTGGGAGGCCAAGATGGATGG - Intergenic
1030658300 7:112192167-112192189 ACTGGGCAGAGGAAGAAAGATGG - Intronic
1030820848 7:114088274-114088296 AGTTCTCAGAGGAGGATGGAGGG + Intronic
1031524933 7:122813071-122813093 ATTGAGCAGAGGAAGAAGAATGG - Intronic
1032417513 7:131748032-131748054 ATATGTCAGAGGAGGAAGGATGG + Intergenic
1032550836 7:132782397-132782419 ACTTGGGAGAGGAAGACGGGAGG + Intergenic
1032641067 7:133768963-133768985 ATTAGGCAGATGAAGACAGAGGG + Intronic
1033421226 7:141206331-141206353 ATTTGGAAGTGGAAGAGCGAGGG + Intronic
1033501129 7:141950795-141950817 AGCAGGCAGAGGAACATGGAAGG + Intronic
1033712590 7:143963804-143963826 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1034535090 7:151721283-151721305 AGATGGCAGAGGAAGCAGGAAGG - Intronic
1034911386 7:155001900-155001922 ATTTCGCAGATGAACTTGGATGG - Intronic
1035673272 8:1436385-1436407 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1035777151 8:2196786-2196808 AGCAGGCAGAGGAAGGTGGAAGG - Intergenic
1036025387 8:4902164-4902186 TTTTGGGAGAACAAGATGGAAGG + Intronic
1036618545 8:10406984-10407006 ATTTGGGAGACCGAGATGGAAGG - Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1039436786 8:37564939-37564961 CTTTAGAGGAGGAAGATGGAAGG - Intergenic
1039594097 8:38775550-38775572 ATTTGGCAGAAGAAGGGAGAGGG + Intronic
1040046591 8:42970894-42970916 ATTTGGCAGGCTGAGATGGAAGG - Intronic
1040056926 8:43066935-43066957 GTTAGGCAGGGGAAGATGGTAGG + Intronic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1042454963 8:68990106-68990128 CTTTGGTTGAGGAAGAGGGAGGG + Intergenic
1043614568 8:82109535-82109557 ATTTGCCAAAGGAAAAGGGAGGG + Intergenic
1043839210 8:85082547-85082569 ATTAGGTAGAGCAAGATGGGTGG + Intergenic
1044346350 8:91108860-91108882 ATTATGCAGAGGAAGAGGAAAGG + Intronic
1044458492 8:92416676-92416698 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1045295482 8:100868676-100868698 ATATGGCAGAGGGAGAGAGAGGG + Intergenic
1045593390 8:103624931-103624953 TTTTGGCAGAAGAATATGGAAGG + Intronic
1046505662 8:115135185-115135207 ATTTGGCAAACAAAGTTGGATGG - Intergenic
1046522759 8:115346340-115346362 ATTTGGCAGAGGTGAGTGGAAGG + Intergenic
1047414835 8:124655740-124655762 ATTGGGGAGAGAAAGAGGGATGG + Intronic
1047762705 8:127966023-127966045 TTTTGCCAGAGGCACATGGAGGG + Intergenic
1048345365 8:133571426-133571448 CTTTGGGAGAGGAAGAAGGTCGG - Intronic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1048634819 8:136284492-136284514 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1048776554 8:137953141-137953163 AAATGGCAAAGGAACATGGATGG - Intergenic
1049425478 8:142536143-142536165 AGTTGGCAGAGGCAGAAAGAGGG - Intronic
1050018332 9:1259326-1259348 ATTTGGTAGGGGATGAGGGAGGG - Intergenic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1051490234 9:17655318-17655340 GTTGGGCACAGGAAGAGGGAGGG - Intronic
1052039490 9:23721686-23721708 AGTAGGCAGAGGAAGAGGGAGGG - Intronic
1052402573 9:28019120-28019142 ACTTGACAGATGAAGATGGGAGG + Intronic
1052631439 9:31046474-31046496 ATTTTACAAAGGAAGAAGGAAGG - Intergenic
1052682039 9:31706035-31706057 AAATGGCAGAGGAAGAGGAAAGG + Intergenic
1052935025 9:34085801-34085823 ATGTGGCAGAAGAATAGGGACGG + Intergenic
1053622097 9:39829884-39829906 ATTTGGGAGATGAAGATAGGAGG + Intergenic
1053826927 9:42034967-42034989 ATCTGGGAGACGAAGGTGGAAGG - Intronic
1053882988 9:42614391-42614413 ATTTGGGAGATGAAGATAGGAGG - Intergenic
1053889681 9:42679910-42679932 ATTTGGGAGATGAAGATAGGAGG + Intergenic
1054222012 9:62421861-62421883 ATTTGGGAGATGAAGATAGGAGG - Intergenic
1054228702 9:62487311-62487333 ATTTGGGAGATGAAGATAGGAGG + Intergenic
1054603633 9:67152464-67152486 ATCTGGGAGACGAAGGTGGAAGG + Intergenic
1055652419 9:78419335-78419357 AAGTGGCAAAGGAGGATGGATGG + Intergenic
1055865506 9:80808685-80808707 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1055888239 9:81091978-81092000 ATGGGGCAGAGCAACATGGAAGG + Intergenic
1057404675 9:94758160-94758182 ATTTGGCAGGTGGAGGTGGAAGG + Intronic
1057836300 9:98448122-98448144 ACTGGGCAGAGGATGAAGGATGG + Intronic
1057866384 9:98685115-98685137 AGCAGGCAGAGGAAAATGGAAGG + Intronic
1058040179 9:100294205-100294227 ACTGGGGAGAGGAAGACGGATGG + Intronic
1058302523 9:103393807-103393829 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1059319659 9:113458992-113459014 CTTTGGGAGACCAAGATGGATGG - Intronic
1060886093 9:127153630-127153652 ATTGGGGAGAGGAAGCTGCAAGG - Intronic
1060944978 9:127564980-127565002 ATTTAACGGAGAAAGATGGAGGG + Intronic
1061338477 9:129959824-129959846 CTAGGGCTGAGGAAGATGGAGGG - Intronic
1061640136 9:131947187-131947209 CTTTAGCAGAGGAAGATGTGAGG + Intronic
1061970992 9:134045408-134045430 GTGTTGCAGAGGAAGATGGATGG - Exonic
1062135904 9:134928210-134928232 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1062179240 9:135181893-135181915 ATCAGGCAGAGGAAGGTGGAAGG + Intergenic
1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG + Intergenic
1187575737 X:20552750-20552772 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1188012585 X:25073575-25073597 AGCAGGCAGAGGAACATGGAGGG - Intergenic
1188707600 X:33355247-33355269 AACAGGCAGAGGAACATGGAAGG + Intergenic
1189784713 X:44549108-44549130 AATTGGAAGAGTAAAATGGAGGG + Intergenic
1190538465 X:51453328-51453350 TTTTGGCATAGTAAGATGAATGG - Intergenic
1192439928 X:71166867-71166889 TTTTGGCAGGGGATGATGTAGGG - Intronic
1195534370 X:105994499-105994521 ATCTGGCAGAAGGAGAAGGAGGG - Intergenic
1195598704 X:106722131-106722153 GTTTGGAAGAGGAGGGTGGAAGG + Intronic
1195678858 X:107528489-107528511 TTTTGGCAGAAGTAGATAGAAGG + Intronic
1196230747 X:113218068-113218090 AGCAGGCAGAGGAACATGGAAGG - Intergenic
1196534691 X:116829399-116829421 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1196758898 X:119181952-119181974 GTTTGGCAAAGGAAGCAGGAGGG - Intergenic
1196961479 X:121007777-121007799 ATTTGGCAGAGACAGAAGGCAGG - Intergenic
1197596604 X:128471339-128471361 AGCAGGCAGAGGAACATGGAAGG + Intergenic
1197713259 X:129687344-129687366 TTTGGGCAGAAGAAGATGGATGG + Intergenic
1197785404 X:130192636-130192658 ATTTGGCAGAGGTAGCTGCAGGG - Intergenic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1199022838 X:142902614-142902636 ATCAGGCAGAAGAAGTTGGAAGG - Intergenic
1199201884 X:145100403-145100425 ATTTGACAGAGAGAGAGGGAGGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1201219269 Y:11750965-11750987 ATTAGGGAGTGGAAGGTGGAAGG - Intergenic
1201908226 Y:19106545-19106567 ATTTGCTTGAGGAAGGTGGAAGG + Intergenic