ID: 967201987

View in Genome Browser
Species Human (GRCh38)
Location 3:187079831-187079853
Sequence TGGCCCTCCATTTCCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967201987_967201995 8 Left 967201987 3:187079831-187079853 CCTCCCAAGGAAATGGAGGGCCA 0: 1
1: 0
2: 0
3: 10
4: 198
Right 967201995 3:187079862-187079884 GGCCTGCCCTGCCTGTGGATAGG 0: 1
1: 0
2: 3
3: 31
4: 361
967201987_967201994 3 Left 967201987 3:187079831-187079853 CCTCCCAAGGAAATGGAGGGCCA 0: 1
1: 0
2: 0
3: 10
4: 198
Right 967201994 3:187079857-187079879 GAATGGGCCTGCCCTGCCTGTGG 0: 1
1: 0
2: 7
3: 37
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967201987 Original CRISPR TGGCCCTCCATTTCCTTGGG AGG (reversed) Intergenic
900473156 1:2864298-2864320 TGGCCAGGCATTTCCTGGGGAGG - Intergenic
900538955 1:3193295-3193317 TGCCGCTCCATCCCCTTGGGGGG - Intronic
900644243 1:3701937-3701959 TGGCCCCCCAGGTCCCTGGGAGG + Intronic
902807317 1:18869192-18869214 TGGCCCCTCATTTCCTTAGAGGG + Intronic
904970511 1:34415959-34415981 TTTCCCTAAATTTCCTTGGGGGG - Intergenic
907716767 1:56933345-56933367 AGGGACTCCATTTCCTTGGCAGG + Exonic
908514148 1:64875187-64875209 TCGCCCTCCATTGCCAGGGGAGG + Intronic
914465384 1:147923547-147923569 TGGTCCTTCATCTCCTTGGAAGG + Intergenic
916560399 1:165929952-165929974 TCTCCTTCAATTTCCTTGGGGGG - Intergenic
917676097 1:177320906-177320928 TGGCCCTCCACTTCATTTTGGGG + Intergenic
918277711 1:182969709-182969731 CGGCCCTCCATATCTGTGGGGGG + Intergenic
920439091 1:205966623-205966645 GGGCCTTCTCTTTCCTTGGGTGG + Intergenic
920598499 1:207297782-207297804 TGGCCCTCAGCTTCCTTAGGTGG + Intergenic
923514908 1:234688515-234688537 TGGCCCTCCTTTATCTAGGGGGG + Intergenic
1064704685 10:18059608-18059630 TCTCCCTTCATTTGCTTGGGTGG + Intergenic
1066420214 10:35258457-35258479 TGGCCCTTCATTTCCAGAGGAGG + Intronic
1066657852 10:37712082-37712104 TGGGCCTCCATTTTCTTGTCTGG + Intergenic
1067042334 10:42961710-42961732 TGGGCCTCCATTTTCTTGTCTGG + Intergenic
1067186469 10:44032482-44032504 AGGCCCTTGATGTCCTTGGGTGG - Intergenic
1069003450 10:63291854-63291876 TGTCTCTTCATTTCTTTGGGTGG + Intronic
1069903218 10:71717668-71717690 GGCCCCTCCACTTCCTTGAGAGG - Intronic
1071434131 10:85631158-85631180 TGAGCCTCAATTTCCCTGGGTGG - Intronic
1072371815 10:94772090-94772112 TGGCCCTCCATTTCATTTTTGGG - Intronic
1072706405 10:97684245-97684267 TTGCCCTTCTTTTCCTGGGGAGG - Intronic
1074498248 10:113998902-113998924 TGGCCCTATATTTTCTTGGTAGG - Intergenic
1074742800 10:116501052-116501074 TGGCCCTCCATTTCATTTTTAGG - Intergenic
1075555464 10:123427877-123427899 TTTCCTGCCATTTCCTTGGGAGG + Intergenic
1075879532 10:125838827-125838849 TGGCCCTTTATTCCCTTGAGGGG + Intronic
1079515149 11:21258619-21258641 TTGCCCTCCATTACCTAGGTGGG - Intronic
1081602779 11:44506712-44506734 TGGCCCAGCATTGCCTTGAGTGG - Intergenic
1083051633 11:59782261-59782283 TGACCTTAGATTTCCTTGGGTGG + Intronic
1083264874 11:61542093-61542115 CGGCCCTCCATCCCCTTGGCAGG - Intronic
1084513945 11:69625555-69625577 TGCCCCTCCATTTGGCTGGGAGG - Intergenic
1085078210 11:73610932-73610954 TGGCCTTCTATTTTTTTGGGTGG + Intergenic
1086801781 11:91184614-91184636 TTACCCACCACTTCCTTGGGTGG + Intergenic
1088492385 11:110400737-110400759 TGGCCCTCCATTTCATTTTTGGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1092782494 12:11999932-11999954 TGATACTCCTTTTCCTTGGGTGG + Intergenic
1094095490 12:26699692-26699714 TGGCCCTGGATTTATTTGGGTGG - Intronic
1098197102 12:68013691-68013713 TAGCCCTCCATTTCATAGGTAGG + Intergenic
1099687779 12:85911143-85911165 GTGCCCTCCTTTTGCTTGGGAGG - Intergenic
1100209646 12:92388023-92388045 TGGCCCTCCATTCCATTTTGAGG + Intergenic
1100354717 12:93818435-93818457 GAGGCCTCCATTTCCTTGGCAGG + Intronic
1100530454 12:95456983-95457005 TGGCCCTCCACTTCATTTTGAGG - Intergenic
1101970787 12:109310374-109310396 TGGTCCTCCTTTTGCATGGGGGG + Intergenic
1104766949 12:131336206-131336228 TGGCCCTCCACTCCCTTTTGGGG + Intergenic
1106234949 13:27853652-27853674 TGGACTTCATTTTCCTTGGGGGG - Intergenic
1106652426 13:31705976-31705998 AGGCCCAACAATTCCTTGGGTGG - Intergenic
1113551672 13:111197546-111197568 TGGCCCTCCACTTCATTTTGGGG - Intronic
1114060952 14:19015465-19015487 TGGCCATCCACTTCCTTGACTGG - Intergenic
1114101304 14:19384514-19384536 TGGCCATCCACTTCCTTGACTGG + Intergenic
1114271857 14:21105175-21105197 TGGCGCTCCATGAGCTTGGGAGG - Intergenic
1114473252 14:22978030-22978052 TGGCCCTCCAGCTTCTTGGTGGG - Intronic
1114799209 14:25753542-25753564 ACTTCCTCCATTTCCTTGGGTGG - Intergenic
1115285622 14:31710666-31710688 TGGCCCTCCACTTCATTCTGGGG - Intronic
1116357360 14:43946016-43946038 TGTCATTCCATTTACTTGGGAGG + Intergenic
1121884781 14:97533268-97533290 AGGCCCTCCTTTTCCCTGTGGGG + Intergenic
1122264466 14:100540229-100540251 TTGCCCTCGGTTTCCTTTGGGGG - Intronic
1124624307 15:31299277-31299299 TGCCCAGCCATTTCCCTGGGAGG - Intergenic
1125471233 15:40005906-40005928 TGGCCCTCTACATCCTTGGGTGG + Intronic
1126036922 15:44555144-44555166 AGGGCCTCCATTTCTTTGTGCGG + Intronic
1126267642 15:46773467-46773489 TGGACCTCCCTTTGCTTTGGGGG - Intergenic
1130699812 15:86166846-86166868 TGGTCCTTCATATCCTGGGGAGG + Intronic
1131379035 15:91948694-91948716 TGGCTCTCCTATTCCTTGGACGG - Intronic
1132374601 15:101320703-101320725 TGGCCCTCCATCTCTTCAGGGGG - Intronic
1133781461 16:8942230-8942252 AAGCCATCCATGTCCTTGGGAGG + Intronic
1135397359 16:22141463-22141485 TGGAGCCCCATTTCCTGGGGTGG + Intronic
1135941342 16:26824748-26824770 TGGCCTTCCAGATCCTGGGGAGG + Intergenic
1136109834 16:28057784-28057806 TGGGCCTCAGTTTCCTTGGCTGG - Intronic
1136310963 16:29409910-29409932 TGTCCTCCCAGTTCCTTGGGGGG + Intergenic
1137354661 16:47749050-47749072 TCTCCCTCCTTTTTCTTGGGGGG - Intergenic
1139845822 16:69920467-69920489 TTGCCTGCCATTTTCTTGGGTGG + Intronic
1140898047 16:79342493-79342515 TGGCCCTAAATTTCCTGGGCAGG + Intergenic
1141432362 16:83977000-83977022 AAACCCTCCATTTCCTCGGGTGG - Intronic
1141479778 16:84298813-84298835 TTGCCTTCCATTCCCGTGGGAGG + Intronic
1141669653 16:85485168-85485190 TGTCGCTCCACTTCCTTGGGAGG - Intergenic
1141685837 16:85569447-85569469 TGGGCCTCAGTTTACTTGGGTGG + Intergenic
1143890129 17:10096536-10096558 TGGCACTCCATTTTCCTGTGGGG + Intronic
1144014357 17:11179870-11179892 TGGAACTCCATATACTTGGGTGG - Intergenic
1144524128 17:15975431-15975453 AGGCAGTCCATTTCCTTGTGAGG - Exonic
1144659665 17:17059990-17060012 TGGCCCAGCTTTTCCTGGGGTGG + Intronic
1146902597 17:36598331-36598353 TGGACCTCAGTTTCCTTGGTGGG + Intronic
1149627013 17:58086885-58086907 TGGCCCTGTATTTCCCAGGGTGG + Intronic
1151917605 17:77129935-77129957 TGGCACTCCCTTTCCTTTGCTGG - Intronic
1153151660 18:2102121-2102143 TGACCTTCCATTTCCTTAGCAGG + Intergenic
1153595883 18:6724916-6724938 TGGCCCTCCTGATCCTGGGGTGG - Intergenic
1153988802 18:10376814-10376836 TGCCTTTCCATTTCCTTTGGGGG + Intergenic
1155498151 18:26462623-26462645 TGGCCATTCATTTTCTTGGCAGG + Intronic
1158391958 18:57051507-57051529 GGGCCCTCCCTTTCCTTGGAGGG - Intergenic
1161450433 19:4342755-4342777 CGGCCCTCCATACCCTTGGGCGG - Intronic
1163283455 19:16331380-16331402 TGTGCCTCAGTTTCCTTGGGTGG + Intergenic
1164993134 19:32698908-32698930 TGGCCCTCCACTTCATTTTGGGG - Intronic
1166300094 19:41908247-41908269 TTGCCCGCCTTTGCCTTGGGGGG + Intronic
1166670676 19:44707893-44707915 TGGCCCTCCGTTGGCTTGGTGGG - Exonic
1168375551 19:55876264-55876286 TGTCCCTCCATATCCATAGGAGG + Intronic
925213717 2:2073821-2073843 TGTCCCTCCATTTCCAAGGAAGG + Intronic
926238556 2:11068046-11068068 GGGGCCTCCATTGCCTTGTGGGG - Intergenic
927200270 2:20573860-20573882 TGGCCCTCCTTGTCCTGGTGGGG - Intronic
928746157 2:34418484-34418506 TGGCACTCCTGTTACTTGGGAGG - Intergenic
931540309 2:63323589-63323611 TGGCCCTCCACTTCATTTGGGGG + Intronic
932186187 2:69698405-69698427 ACTCCCTCCATTTCCTTGGCTGG + Intronic
936976779 2:118228738-118228760 TGACCCTCCATTTGCTTTGTGGG + Intergenic
937340952 2:121090218-121090240 GTGCCCTCCTTTCCCTTGGGAGG + Intergenic
939022120 2:136970342-136970364 TGGTCCTCCTGCTCCTTGGGAGG + Intronic
941243242 2:163068016-163068038 TGGCCCTCCACTTCATTTTGGGG + Intergenic
941757026 2:169197874-169197896 TGCCCTTTGATTTCCTTGGGAGG + Intronic
942755978 2:179342074-179342096 TAGCCCTCCTTTACCTTGGAGGG + Intergenic
944678303 2:202052930-202052952 TGGCTCTCCATTTCCTGGAAAGG - Intergenic
945273846 2:207968541-207968563 AAGCCCTCCATAGCCTTGGGAGG + Intronic
945702575 2:213190138-213190160 AGGCCCTTCATTTCGTTGGTTGG - Intergenic
946203857 2:218089429-218089451 TGTCCCTCCCTTCCCTGGGGTGG - Intronic
947568062 2:231208424-231208446 TGGCCACACATTTCCTGGGGAGG - Intronic
948372724 2:237500385-237500407 TGGTGCTCCATAGCCTTGGGTGG - Intronic
1168995874 20:2132853-2132875 TGGGCCCCCATTTCCTTGTCTGG + Intronic
1172620074 20:36312958-36312980 TGGGCCTCCATCTACTTGGTGGG + Intronic
1173679387 20:44866701-44866723 TGGCGATCCATTTCTTTGGTGGG - Intergenic
1174387158 20:50194008-50194030 TGCCCCTCCTTTTCCTTTTGGGG + Intergenic
1175858525 20:62135956-62135978 GGGCCCTCCCATTTCTTGGGTGG + Intergenic
1175959102 20:62626096-62626118 TGGCCCTGCAGTGCCTGGGGCGG + Intergenic
1177792422 21:25735319-25735341 TGAGCCTCCGTTGCCTTGGGCGG + Intronic
1178921704 21:36743174-36743196 TGGCTCAGCATTTCCTGGGGTGG + Intronic
1180479435 22:15738077-15738099 TGGCCATCCACTTCCTTGACTGG - Intergenic
1181389507 22:22569893-22569915 TGGGTCTTCATTTCCTTGTGAGG - Intergenic
950714027 3:14835119-14835141 TGGCTCGCCATTTCCTAAGGCGG - Intronic
953465303 3:43114604-43114626 TGGCTCTCCATGTCCCTGGTGGG + Intergenic
954232437 3:49227725-49227747 TGGCCCTCCATTTCATTTTGGGG - Intronic
954598748 3:51851430-51851452 TGGCCCTCCACTTCATTTTGGGG + Intergenic
954889659 3:53913472-53913494 GGGCCCTTCATACCCTTGGGAGG + Intergenic
956785212 3:72636856-72636878 TGGGCCTCCATTTTCTTGTTTGG + Intergenic
956843156 3:73158317-73158339 TGGCCCTCCATTTCATTTTTGGG - Intergenic
958041501 3:88231446-88231468 TGACTCACCATTTCCTCGGGTGG + Intergenic
958744406 3:98114675-98114697 TGGCCCTTCCTTTTCCTGGGTGG + Intergenic
959037664 3:101385308-101385330 TGGTCATCCTTGTCCTTGGGTGG - Intronic
960001359 3:112735234-112735256 CGGTCCTCCCTTTCCTTGGCAGG + Intergenic
963016041 3:140824921-140824943 TGAACCTCCATTTCCTTATGTGG + Intergenic
963021091 3:140873694-140873716 TGGCCCTCCACTTCATTTTGGGG + Intergenic
963037144 3:141040593-141040615 TGTCGCTCCAGTTACTTGGGTGG - Intergenic
963082392 3:141406320-141406342 TGCCCCTCTTTTTCCTTGGTGGG - Intronic
966878529 3:184336839-184336861 TGGGCCTCGGTTTCCGTGGGTGG + Intronic
967201987 3:187079831-187079853 TGGCCCTCCATTTCCTTGGGAGG - Intergenic
970434721 4:16022255-16022277 TGGGCCTCCGTTTCCTTGCCTGG + Intronic
971237616 4:24856855-24856877 TGGCCCTCCATCTGGTAGGGAGG - Intronic
971279390 4:25230073-25230095 GTGCCCTCCCTATCCTTGGGAGG + Intronic
971770345 4:30887492-30887514 TAGCCCTCCATTCCATTTGGAGG - Intronic
972048238 4:34695492-34695514 TGCCCTTCCATCTCCTTTGGAGG - Intergenic
975047824 4:69826196-69826218 TGGCCCTCCACTTCATTCTGGGG + Intronic
977846490 4:101773505-101773527 TGGCTCTCCATTTCTCTGAGTGG - Intronic
979485681 4:121267336-121267358 GGGCCCTTCATTTGCCTGGGAGG + Intergenic
986027063 5:3860546-3860568 TGGGCTTCCATTTCCATGTGTGG - Intergenic
987929491 5:24386591-24386613 TGGATCTCTATTTCATTGGGAGG - Intergenic
989506017 5:42228717-42228739 TGGCTCTGCATTTCTTTGGGTGG - Intergenic
991355691 5:65766953-65766975 TGGGCCCCCATGGCCTTGGGTGG + Intronic
992049167 5:72927589-72927611 TGGCCCTCCATTTCATTTTTGGG + Intergenic
994578144 5:101607859-101607881 TGGCCCTCCTTATCCATGTGAGG + Intergenic
997719447 5:136065936-136065958 TCTCCTTCCATTTCCTTGGTTGG - Intergenic
999325377 5:150640491-150640513 TGATCCTCCATGTCCTGGGGAGG + Intronic
1001875361 5:175195463-175195485 TGGGTCTTCATTTCCTTGTGAGG + Intergenic
1004378999 6:15116046-15116068 TGTCCTTCCAGTTCCTTGGTGGG - Intergenic
1006410513 6:33870882-33870904 TGTCCCTCCACTCCCTTGCGTGG + Intergenic
1007635770 6:43298791-43298813 GGGCCTGCCATTGCCTTGGGTGG + Intronic
1008464330 6:51813929-51813951 TGATTCTCCATTTCCTTTGGAGG + Intronic
1009324924 6:62338283-62338305 TGGTTCTCCATTTCCCTGGGAGG + Intergenic
1009603797 6:65838770-65838792 TGGCCCCTCCTTTTCTTGGGTGG + Intergenic
1012526912 6:100188852-100188874 TGGCCCTCCATCACATTGGACGG + Intergenic
1015765899 6:136716087-136716109 TAATTCTCCATTTCCTTGGGAGG + Intronic
1015929164 6:138339641-138339663 TGTCCCTCCATATACTTGGCTGG - Exonic
1017866065 6:158444299-158444321 TGCCCCTCCTTTTCTTTGGAAGG - Intronic
1019333576 7:472050-472072 TGGCCCTCCCTTCCCTTGGAGGG - Intergenic
1020040717 7:4998868-4998890 ACTCCCTCCATTTCCTTGGCTGG + Intronic
1023758206 7:43439859-43439881 GTGCTCTCCATTTCCCTGGGTGG - Intronic
1026966999 7:74446404-74446426 TGGACCTCCATGTTCTTGGAGGG - Intergenic
1028082658 7:86598538-86598560 TCGCTCACCACTTCCTTGGGCGG - Intergenic
1031345618 7:120662051-120662073 TGGCTCTTCATTTCCTTATGAGG + Intronic
1031972922 7:128076940-128076962 GGGCTCTCCACTTCCTTGGCAGG + Intronic
1033653052 7:143356400-143356422 TGGTCCTCCATTTCCAGGAGAGG + Exonic
1037643662 8:20771157-20771179 TGGCCCTCCTTTGCAGTGGGTGG + Intergenic
1037818085 8:22122405-22122427 TGGCCCCCCCTTTTCTTGGTGGG - Intronic
1038302377 8:26364861-26364883 TGGCCCTCCATATATTTGAGGGG - Intronic
1038506154 8:28086867-28086889 TGGACCTCCATTTCCCTGCCAGG + Intergenic
1040333657 8:46405155-46405177 TGGCCCTGTCTTTGCTTGGGGGG - Intergenic
1043500464 8:80849329-80849351 TAGCCATCCATTTCCCTTGGTGG - Intronic
1043884962 8:85588346-85588368 GTGCCCTCCTTATCCTTGGGAGG - Intergenic
1044080237 8:87873961-87873983 TTGCTCTCCATTTCGTTCGGCGG + Exonic
1044456831 8:92399610-92399632 TGGCCCTCCACTTCATTTTGGGG - Intergenic
1044518587 8:93169694-93169716 TGGGACTTCATTTCCTTGGGTGG - Intergenic
1047760347 8:127949785-127949807 TGGGCCTCCCTGTCCCTGGGTGG - Intergenic
1048054800 8:130853104-130853126 TGGACCTCATTTTCCTTGGAGGG + Intronic
1048283120 8:133120031-133120053 TGGGCCTCCCTTGCCATGGGTGG - Intronic
1048770716 8:137891604-137891626 TGGACCTCCATTGCCTTCAGTGG - Intergenic
1050579788 9:7041093-7041115 TGGCCCTCTGTATCCATGGGTGG + Intronic
1051308156 9:15738587-15738609 TGGCCTTTAATCTCCTTGGGTGG + Intronic
1052442744 9:28518764-28518786 TGGGCCTACATTTCCTTTTGAGG + Intronic
1054736108 9:68751614-68751636 TGGCCCTTCATTTTGTTGGTAGG + Intronic
1055333735 9:75210231-75210253 TTGCCCTCCATTTTATTGGTGGG + Intergenic
1055458481 9:76494383-76494405 TGGCCCTCCACTTCATTTTGGGG - Intronic
1055604399 9:77953227-77953249 TGGTCCTACATTTCCTGGGATGG - Intronic
1058175314 9:101729151-101729173 TGGCCCACCTTATCCTTGGAAGG - Intronic
1059153537 9:111970128-111970150 TGGGCCTGCATTTCCTACGGAGG - Intergenic
1061780876 9:132995386-132995408 TGGGCCTCTGTTTCCTTGTGTGG - Intergenic
1186451343 X:9676358-9676380 TAGCCCGCCATTGCCCTGGGAGG + Intronic
1186563775 X:10640322-10640344 TTGCCCCCCATTTGCTTGGTAGG - Intronic
1193369600 X:80678683-80678705 TGGTCCTCCATTTTCTTTGTTGG - Intronic
1194973115 X:100366060-100366082 AGGCAGTCTATTTCCTTGGGTGG - Intronic
1196543578 X:116937336-116937358 TGGGCTTCCATGGCCTTGGGTGG + Intergenic
1200324432 X:155222962-155222984 TAGCCCTCCAACTACTTGGGAGG - Intronic
1201429486 Y:13890223-13890245 TGGCCCTCCACTTCATTTTGGGG + Intergenic
1201487368 Y:14507593-14507615 TGGCCCTCCACTTCATTTTGGGG + Intergenic
1201496604 Y:14596048-14596070 TGGCCCTCCATTTCATTTTTGGG - Intronic
1201631064 Y:16072534-16072556 TGGCCCTCCACTTCATTTTGGGG + Intergenic