ID: 967210666

View in Genome Browser
Species Human (GRCh38)
Location 3:187165423-187165445
Sequence CAGTCAGACAGAGCTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967210666_967210669 18 Left 967210666 3:187165423-187165445 CCAAGTTCAGCTCTGTCTGACTG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 967210669 3:187165464-187165486 GAACAGAAAGAAATTTGGCATGG 0: 1
1: 0
2: 3
3: 59
4: 636
967210666_967210668 13 Left 967210666 3:187165423-187165445 CCAAGTTCAGCTCTGTCTGACTG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 967210668 3:187165459-187165481 CATCAGAACAGAAAGAAATTTGG 0: 1
1: 1
2: 0
3: 43
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967210666 Original CRISPR CAGTCAGACAGAGCTGAACT TGG (reversed) Intronic