ID: 967215593

View in Genome Browser
Species Human (GRCh38)
Location 3:187207339-187207361
Sequence GTGTCCTCAGAGTACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967215587_967215593 9 Left 967215587 3:187207307-187207329 CCACACCTTGGCCTGCTTGAGTT No data
Right 967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG No data
967215588_967215593 4 Left 967215588 3:187207312-187207334 CCTTGGCCTGCTTGAGTTCTTGC No data
Right 967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG No data
967215592_967215593 -2 Left 967215592 3:187207318-187207340 CCTGCTTGAGTTCTTGCTGGGGT No data
Right 967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG No data
967215585_967215593 27 Left 967215585 3:187207289-187207311 CCAGATCTGCAGCATGAGCCACA No data
Right 967215593 3:187207339-187207361 GTGTCCTCAGAGTACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967215593 Original CRISPR GTGTCCTCAGAGTACTGTGC TGG Intergenic
No off target data available for this crispr