ID: 967217498

View in Genome Browser
Species Human (GRCh38)
Location 3:187222970-187222992
Sequence AAAGTCCCATTGAACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967217493_967217498 18 Left 967217493 3:187222929-187222951 CCATGACATGTAGAACAAACAAA 0: 1
1: 0
2: 1
3: 32
4: 326
Right 967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG 0: 1
1: 0
2: 0
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967217498 Original CRISPR AAAGTCCCATTGAACTTTGG AGG Intronic
901235017 1:7663107-7663129 AAAGCCCCTCTGATCTTTGGAGG + Intronic
901464800 1:9414100-9414122 AAAATCCCAAGGAATTTTGGAGG - Intergenic
901590564 1:10338129-10338151 AAAGACAAATTGAAGTTTGGAGG - Intronic
902274504 1:15329533-15329555 AAAGTCCCAGTAACCTTTGTTGG - Exonic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
904446117 1:30574159-30574181 AAAGCTCCATTGCACTTTGATGG + Intergenic
906675851 1:47693239-47693261 ACAGCCCCATTGAAAGTTGGTGG + Intergenic
907774023 1:57495131-57495153 TAACTCACATTGAGCTTTGGGGG - Intronic
908011950 1:59786990-59787012 AAAGTTCCATAGATCTCTGGAGG + Intergenic
911115593 1:94243306-94243328 GAAGTCCCAATGAACTTAAGAGG + Intronic
911334302 1:96562540-96562562 AAAGTTCCTCTGAGCTTTGGGGG - Intergenic
911621513 1:100071098-100071120 AAAGTGCTTTTTAACTTTGGAGG + Intronic
911678214 1:100683568-100683590 AAAGTCCCATTGAAGTAGGTGGG - Intergenic
912497382 1:110100358-110100380 AAAGACCCCTGGAACTTGGGAGG - Intergenic
915218306 1:154354462-154354484 AAAGTGACATTGAACCTTTGTGG - Intergenic
916934771 1:169616210-169616232 TTAGATCCATTGAACTTTGGTGG - Intronic
918492934 1:185101881-185101903 AAAGTTCCCTTGATTTTTGGTGG - Exonic
918694014 1:187520071-187520093 AAGTTCTCATTGATCTTTGGTGG + Intergenic
919070479 1:192749197-192749219 TAAGTCCTTTTGAATTTTGGAGG - Intergenic
919604163 1:199660288-199660310 CAAGTCCATTAGAACTTTGGAGG - Intergenic
920759356 1:208767356-208767378 AAGTTCCCACTTAACTTTGGGGG - Intergenic
922315756 1:224440317-224440339 AAAGACCACTTGAACTTTGGAGG - Intronic
923052566 1:230398998-230399020 AAAGAGCCATTGAATTTTGTGGG - Intronic
923615360 1:235532924-235532946 AAGGCCCCATTGAATTTTAGGGG - Intergenic
924599585 1:245476889-245476911 ATTGTCCCTTTGAACTATGGGGG - Intronic
924645485 1:245873513-245873535 AAACTCACCCTGAACTTTGGAGG - Intronic
1063584183 10:7336385-7336407 AAAGTTGCCTTGAAGTTTGGTGG - Intronic
1063771166 10:9202938-9202960 AAAGTCCCAATGACCTTTCAAGG - Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068810151 10:61246241-61246263 AAAGTCACTTTGAAATGTGGTGG + Intergenic
1069363343 10:67669743-67669765 AAAATGCCATTGAATTTTAGAGG + Intronic
1070126921 10:73629891-73629913 AAAGTCCCTTTGAGCTATTGGGG - Intergenic
1070581703 10:77725268-77725290 ATACTCCCATTGTACCTTGGAGG + Intergenic
1071135411 10:82447721-82447743 AAAGTATTACTGAACTTTGGAGG + Intronic
1074071809 10:110078797-110078819 ACTGTCCCTTTGAACTCTGGAGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078472529 11:11603041-11603063 ATAGTCCCTTTGAACTTTTCAGG - Intronic
1080593897 11:33750795-33750817 ATAGTCCTATTAAACTTTGAAGG + Intronic
1081086566 11:38809512-38809534 AAAGTCCCTTTGTACTGAGGGGG + Intergenic
1081698461 11:45136208-45136230 AAAGTTCCATTGGATTTTGAAGG + Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085216552 11:74837806-74837828 TCAGTCCCATGGACCTTTGGGGG + Exonic
1088577005 11:111282063-111282085 ATAGTGCCATTGAAATTTGGTGG + Intronic
1089266756 11:117269297-117269319 AAGGTTCTTTTGAACTTTGGGGG + Intronic
1090929916 11:131288140-131288162 AAAGTCTCTTTGAACTTAGAAGG - Intergenic
1091154992 11:133363743-133363765 AGAGCCCCACTGACCTTTGGGGG - Intronic
1092004334 12:5056468-5056490 AAGTTCCCATTGAACTTTAAGGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1094143698 12:27206828-27206850 AAGGTTCCTTTGGACTTTGGTGG - Intergenic
1095139820 12:38647780-38647802 AAAGTCCCATTGCTCTGTGAAGG - Intronic
1095771649 12:45966314-45966336 AAAGGCCCAGTGATCTTTTGTGG + Intronic
1098086662 12:66852055-66852077 AAAATCCAATTGAACTTTAGGGG + Intergenic
1099571874 12:84331821-84331843 TTAGTCCCATTGAACTGAGGGGG + Intergenic
1100268077 12:92997570-92997592 AAAATCCCAGTAAAATTTGGGGG + Intergenic
1100818710 12:98410799-98410821 AAAATCCCATGAAACTTTGATGG - Intergenic
1102247927 12:111366976-111366998 AAGGACCCCTTGAACTTGGGGGG + Intronic
1102595050 12:113985933-113985955 AAAGTGCCATTTTTCTTTGGGGG + Intergenic
1102802873 12:115751748-115751770 AAAGTCCCCTTGACCTTTCCTGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1106188845 13:27432658-27432680 AAAGTGCCATTGACCTTGAGCGG + Intronic
1107355146 13:39558411-39558433 AATGTCCTATTGAACTTTGCTGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108050816 13:46436509-46436531 AAAGTCTGATTGAAGTTTGTTGG - Intronic
1108314450 13:49223706-49223728 AAAGTCACATTGAGACTTGGAGG + Intergenic
1109543388 13:63810134-63810156 AAAGTCTGATTGAAGTTTGTTGG - Intergenic
1111919325 13:94394059-94394081 AGAGTCCTATGGAAATTTGGGGG - Intronic
1111994611 13:95152324-95152346 AAAGTCCCATTGTTCTTTATGGG + Intronic
1112505639 13:99973461-99973483 AAAGTCCATTTGAAATTTGATGG - Intergenic
1116266941 14:42704280-42704302 AAAGTCTTATTGAAATTTGTTGG + Intergenic
1117094873 14:52286565-52286587 CAAGTCCCATTCATTTTTGGAGG - Intergenic
1119401327 14:74364673-74364695 AAAGACCCATTCCAGTTTGGTGG + Intergenic
1120477426 14:85005993-85006015 AAAGTTCCTTTGAGCTCTGGGGG + Intergenic
1122548962 14:102539769-102539791 TTAGGTCCATTGAACTTTGGGGG - Intergenic
1129600108 15:76993819-76993841 AAAATCCCCTTGAACTTTGTAGG - Intronic
1132183502 15:99781361-99781383 AAAATCAGATTGAATTTTGGGGG - Intergenic
1132434878 15:101791805-101791827 AAAATCAGATTGAATTTTGGGGG + Intergenic
1138557702 16:57782205-57782227 AATGTCGCATTGCAGTTTGGGGG - Intronic
1139768652 16:69254483-69254505 AAAATCCCCTTTAAGTTTGGTGG + Intronic
1140826832 16:78714705-78714727 GAAGTCCAATGGAACTTGGGCGG + Intronic
1148198267 17:45730366-45730388 AGAAACCCATTGAAATTTGGGGG + Intergenic
1151637959 17:75365659-75365681 AAAGTACAATGGAACTATGGGGG + Intronic
1155595664 18:27483089-27483111 AAAGTCTTTTTGAATTTTGGGGG - Intergenic
1156794247 18:41022709-41022731 TAAGTCCCAGTGAATGTTGGTGG + Intergenic
1157897914 18:51486124-51486146 AAAGTGCCATGGAACTCTAGAGG + Intergenic
1160318850 18:77871759-77871781 AAAGTCCCTTCTGACTTTGGTGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1167164952 19:47792515-47792537 AAGGTCCCAGGGAAATTTGGGGG - Intergenic
927323321 2:21773830-21773852 AAAGTTCCATTTATATTTGGTGG + Intergenic
928935256 2:36669617-36669639 AAAGTCCCATTTAACGTTTCTGG - Intergenic
930206964 2:48597361-48597383 ACAGTCCCAGTGAAGTTAGGTGG + Exonic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
931698380 2:64889215-64889237 AAAGTCCTGTTGAACTCTGGGGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
933037135 2:77413944-77413966 AAAGTCTCATTGATGTTTGAAGG - Intronic
935138376 2:100328562-100328584 AAAATACCATTTACCTTTGGAGG - Intergenic
935760438 2:106315721-106315743 AAAGCCCCAGTGCCCTTTGGAGG - Intergenic
939731963 2:145796028-145796050 AAAATCCCTTTGAACTGGGGTGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940966907 2:159848375-159848397 AATGACACAATGAACTTTGGGGG + Intronic
942284528 2:174402019-174402041 AAGGTAGCCTTGAACTTTGGAGG + Intronic
942487434 2:176454186-176454208 AAACTCCTATAGAACTTAGGTGG - Intergenic
943843584 2:192611540-192611562 AAAGGCCCATTGAAATTCAGGGG - Intergenic
944374167 2:199021430-199021452 AAACTCCCATTGGACTTCAGTGG - Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1170222169 20:13952530-13952552 CAAGTCCCAGTGAACTTAGCAGG - Intronic
1170439456 20:16363822-16363844 AATGTGCCACTGAAATTTGGGGG + Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171458428 20:25284905-25284927 ATATTCACATTGACCTTTGGGGG - Intronic
1172109128 20:32535329-32535351 AAAGTTCCATTGAGCTTCGTAGG + Intronic
1172311854 20:33924586-33924608 AAATTCCTTTTGAAGTTTGGGGG - Intergenic
1172860368 20:38044961-38044983 AAAGTGCCATAGAACTGTAGAGG + Intronic
1174567623 20:51478011-51478033 AAAGTCCTATTGAACAATGCTGG + Intronic
1175083810 20:56442941-56442963 AAAGTCCCTTTGCTCTGTGGAGG + Intronic
1178122239 21:29481003-29481025 AAAGTCCCAGTAGATTTTGGCGG + Intronic
1179930404 21:44567771-44567793 AAAGTGCCACTGACCTTGGGTGG + Exonic
1182744059 22:32592006-32592028 ACAGTGCCCTTGAACTTTGGGGG - Intronic
1183610444 22:38899551-38899573 AAATTCCACTTGAACTTTTGGGG - Intergenic
1184970672 22:48017727-48017749 AAAGTCCCATGGGTCTTTGAAGG + Intergenic
1185079823 22:48703515-48703537 ACAGTCCCAGTGAGCTCTGGTGG + Intronic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
950064922 3:10104422-10104444 AAAGTCCCGGTCCACTTTGGTGG + Exonic
951526019 3:23653773-23653795 AAAGTCACTGTGAGCTTTGGAGG - Intergenic
952484368 3:33795224-33795246 CCAGTCCCATTGCAGTTTGGTGG + Intergenic
953260951 3:41338640-41338662 AAAGATCCAGTGTACTTTGGAGG + Intronic
953783946 3:45896572-45896594 AAGGTCTCATAGAAATTTGGAGG + Intronic
955058715 3:55478147-55478169 AAAGCCCCATGAAACTTTGCAGG + Intronic
956883007 3:73530118-73530140 AAATTCCCATCGCACTCTGGGGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957489358 3:80904549-80904571 AAAGTCACCTTGAACATTGGAGG + Intergenic
959275582 3:104273294-104273316 AAAGTGGCATTGGATTTTGGAGG + Intergenic
963748110 3:149146345-149146367 AAAGTGCCATTGACATTGGGAGG + Intronic
964120795 3:153180993-153181015 AAAGTGCAATTGGAATTTGGGGG + Intergenic
965808878 3:172572320-172572342 AAAGTCCCATAGAAGATAGGAGG + Intergenic
965875120 3:173307577-173307599 AAATTCCTATAAAACTTTGGAGG + Intergenic
967217498 3:187222970-187222992 AAAGTCCCATTGAACTTTGGAGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970095721 4:12461018-12461040 AAAGGGGCATTGAACATTGGAGG - Intergenic
972356386 4:38282763-38282785 AAATCCCCCTTGAATTTTGGTGG - Intergenic
975497486 4:75050925-75050947 AGAGTGCTATTGAATTTTGGGGG - Intergenic
976502238 4:85804885-85804907 AAAGACCCATGGAGCTTTGGAGG + Intronic
977955312 4:103019473-103019495 AGAATCCCATTGAACTGAGGGGG + Intronic
980780965 4:137491734-137491756 AATGTCACATTGTACTTTTGAGG - Intergenic
985115220 4:186583766-186583788 CAAGTCCCATTCACCTTCGGGGG - Intergenic
986589783 5:9356541-9356563 CAAGTCCCTTTGAACTTGGTGGG - Intronic
987603693 5:20105861-20105883 AAAGTTGCAATGAACATTGGTGG + Intronic
989410872 5:41119042-41119064 AAAGTCCCACTGAAGTTCAGAGG - Intergenic
989568669 5:42925246-42925268 AAGGTCCCTTTGAACTAGGGAGG - Intergenic
989639216 5:43566987-43567009 AAATGCCCACTGAACTTGGGGGG - Intergenic
990346577 5:54877394-54877416 AAATTCTCACTGAACTTTTGGGG + Intergenic
993143723 5:84067994-84068016 TAAGTCCCATTCCTCTTTGGAGG + Intronic
994244715 5:97466793-97466815 AGAGTCCCAGTGACCTTTGCAGG + Intergenic
994725055 5:103425474-103425496 AAAGTCCCTTGGAACTATGAAGG + Intergenic
995673449 5:114634427-114634449 AAAGTGCCTTTGAACTTCGAAGG - Intergenic
996489164 5:124072082-124072104 AAAGTCCCATTGACTTTTACTGG - Intergenic
1000483787 5:161813161-161813183 AAAGTTCCATTGAAGTTTGAGGG - Intergenic
1000883713 5:166726620-166726642 ACAGGCCCAGTGAACTTTTGTGG + Intergenic
1001948628 5:175800393-175800415 AAAGTCCCCTTGAACCCAGGAGG + Intronic
1002693963 5:181071618-181071640 AGAATCACATGGAACTTTGGGGG - Intergenic
1003141537 6:3475713-3475735 TTAGTCCCATTAACCTTTGGGGG - Intergenic
1007989374 6:46239384-46239406 GAGCTCCTATTGAACTTTGGTGG + Intronic
1008644322 6:53498139-53498161 AAATACCCATTGAACTCTGATGG - Exonic
1008712424 6:54244086-54244108 AAAGTCATCTTGAATTTTGGAGG + Intronic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012423414 6:99089168-99089190 AAACTTCTATTGAACTTTTGAGG - Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013135779 6:107281599-107281621 AAAGTACCATACAACTTTTGGGG + Intronic
1014090651 6:117400267-117400289 AAATTCCCATGGAAGTTTAGAGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1025533430 7:61918640-61918662 AAAGAAACATTGAACTTTGTTGG - Intergenic
1028314204 7:89379725-89379747 AAAGTCCTATTGAAGTTTTTTGG - Intergenic
1028526087 7:91788465-91788487 AAAGTGACATGAAACTTTGGAGG + Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1033616481 7:143021357-143021379 AAACTCATGTTGAACTTTGGTGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1038987203 8:32824771-32824793 AAAGTACCATACATCTTTGGGGG - Intergenic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1044714396 8:95087414-95087436 AAAGTCCCAGGAAACTTTGGAGG - Intronic
1047303215 8:123632898-123632920 GGAGTCCCATTAAACTCTGGAGG + Intergenic
1048096005 8:131295368-131295390 AAAGTCGCATTGAAAAATGGTGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1050046785 9:1554557-1554579 GAAGCCACATTGAACTTTGTAGG - Intergenic
1050262851 9:3859431-3859453 AAAGTCTCAGTTAACTTTTGGGG - Intronic
1051926594 9:22334978-22335000 AAAATGCCATGGAACTTTGTAGG + Intergenic
1052667361 9:31512290-31512312 AAAGTTTGTTTGAACTTTGGGGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058817712 9:108700873-108700895 AAATTCGAATAGAACTTTGGGGG - Intergenic
1059677640 9:116555173-116555195 AAAGTGCCCTTTAACTTTAGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186123741 X:6390152-6390174 AAAGTCCCTTTGAAAATTGATGG + Intergenic
1186396933 X:9218872-9218894 CATGTCACGTTGAACTTTGGTGG - Intergenic
1186639459 X:11440029-11440051 CAAGCCCCATTCAACTTTGGAGG - Intronic
1186727522 X:12372989-12373011 GAAGTCCTTTAGAACTTTGGGGG + Intronic
1186785905 X:12955837-12955859 AAATTCCCATTTAAATTTGAGGG + Intergenic
1187090222 X:16088499-16088521 AAAGTTCCACTGAGCTTTGGGGG + Intergenic
1190927951 X:54925496-54925518 AAACTCCCAGTGTACTTAGGGGG - Intronic
1192081326 X:68050551-68050573 AAAGTCCAATAGAACTTTTAAGG - Intronic
1192348353 X:70332225-70332247 AAACTCCTACTGAGCTTTGGGGG + Intronic
1197327236 X:125108945-125108967 AAAGTCTCATTAGACTTTGTGGG + Intergenic
1198268119 X:135029984-135030006 AAACTCTCATTAAACTTTGAAGG - Intergenic
1199180246 X:144846109-144846131 AATGCCCCCTTCAACTTTGGTGG + Intergenic
1199665463 X:150093228-150093250 AAATGCCCATAGAACTTTTGGGG + Intergenic
1200943383 Y:8807743-8807765 AAAGTGCCGTTAAACTTTGAGGG + Intergenic