ID: 967218496

View in Genome Browser
Species Human (GRCh38)
Location 3:187229741-187229763
Sequence CTAGGTAGGGAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 408}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967218496_967218505 -2 Left 967218496 3:187229741-187229763 CCTTCCACCTTCTCCCTACCTAG 0: 1
1: 0
2: 4
3: 50
4: 408
Right 967218505 3:187229762-187229784 AGAAGGGAGCCTCCGCAGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 162
967218496_967218504 -3 Left 967218496 3:187229741-187229763 CCTTCCACCTTCTCCCTACCTAG 0: 1
1: 0
2: 4
3: 50
4: 408
Right 967218504 3:187229761-187229783 TAGAAGGGAGCCTCCGCAGAAGG 0: 1
1: 0
2: 0
3: 3
4: 94
967218496_967218508 11 Left 967218496 3:187229741-187229763 CCTTCCACCTTCTCCCTACCTAG 0: 1
1: 0
2: 4
3: 50
4: 408
Right 967218508 3:187229775-187229797 CGCAGAAGGGCTGCCCATTCAGG 0: 1
1: 0
2: 0
3: 5
4: 86
967218496_967218510 24 Left 967218496 3:187229741-187229763 CCTTCCACCTTCTCCCTACCTAG 0: 1
1: 0
2: 4
3: 50
4: 408
Right 967218510 3:187229788-187229810 CCCATTCAGGTGTGACAGCATGG 0: 1
1: 0
2: 1
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967218496 Original CRISPR CTAGGTAGGGAGAAGGTGGA AGG (reversed) Intronic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
901152559 1:7113487-7113509 CTAGGAATGGAGAGGGAGGAAGG + Intronic
901469546 1:9446744-9446766 CAAGGTAGGAAGAAGGGGAAGGG - Intergenic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
902208214 1:14885359-14885381 ATAGGTGGAGAGAAGGGGGAAGG - Intronic
902224778 1:14989772-14989794 GTAGCAAGGGAGGAGGTGGATGG - Intronic
902361077 1:15942995-15943017 CCAGGTGGGGAGCAGGGGGAAGG - Intronic
902746262 1:18476566-18476588 CCAGGCAGGGAGATGGTGGGGGG - Intergenic
902982676 1:20137231-20137253 CTTGGTAGGGGGAGGGTGGAGGG + Intergenic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904456548 1:30651525-30651547 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904456574 1:30651611-30651633 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904557127 1:31372728-31372750 CACGGTAGGGAGGTGGTGGAAGG - Intronic
904702045 1:32363502-32363524 CAAGGTGGGCAGAAGTTGGAAGG + Intronic
905689454 1:39932261-39932283 CTAGGTGAGGAGAAGATGGAAGG + Intergenic
906026797 1:42681333-42681355 GGAAGCAGGGAGAAGGTGGAGGG - Intergenic
906142935 1:43544505-43544527 GCAGGGAGGGAGAAGGTGGGAGG - Intronic
906241959 1:44247796-44247818 ATAGGTGGGGGGATGGTGGAAGG - Intronic
907597848 1:55736074-55736096 CTAGGGAGGGACCTGGTGGAAGG - Intergenic
907887886 1:58610523-58610545 CAAGGGAGGGACAAGGTGGGAGG - Intergenic
908224409 1:62041390-62041412 CTAGGTAGGGAGTGGGTTGGTGG + Intronic
908560172 1:65298302-65298324 CTAGGGTGGGTGAAGGTGGGAGG + Intronic
909055185 1:70812538-70812560 CAAGGTGGGGTGAAGGTGGAGGG - Intergenic
910549049 1:88455275-88455297 CTTGGTAGGGTGAAGGTGTTGGG + Intergenic
910590124 1:88921239-88921261 CTAGGCAGGAAGAAGGTAGAGGG + Intergenic
911306374 1:96237530-96237552 CTAGGTAGGGATAGGGTGGAAGG - Intergenic
911529635 1:99029369-99029391 CCAGGTGTGGAGAAGGTGGGAGG - Intergenic
911871563 1:103107121-103107143 AGAGGGAGGGAGAAGGCGGAGGG + Intronic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912391051 1:109303251-109303273 CTAGGTAGTGAGAGGGTGGTAGG - Intronic
912999112 1:114562150-114562172 AGAGGGAGGTAGAAGGTGGAAGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914351330 1:146842867-146842889 GTGGGTAGGGAGATGATGGATGG + Intergenic
915002898 1:152609740-152609762 CTACTGAGGAAGAAGGTGGAGGG - Intergenic
918243786 1:182642022-182642044 CCAGGTATGGAAAAGGTGGCTGG - Intergenic
919586809 1:199449205-199449227 TTAGCTAGGGAAAATGTGGAGGG + Intergenic
919801795 1:201358867-201358889 CTAGCTGGGGAGAGGGTGGAGGG - Intergenic
919858750 1:201724416-201724438 TAAAGTAGGGAGAAGATGGAGGG - Intronic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920270545 1:204760084-204760106 CTTGGTTGGGAGAAAGGGGAAGG + Intergenic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920813095 1:209305388-209305410 CTAGGTATGGAGAATGTGAAAGG - Intergenic
921314112 1:213874545-213874567 CTAGGTAGGGAAAATATGAATGG + Intergenic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923846089 1:237734411-237734433 CAAGGGAGGGACAAGGTGGGAGG - Intronic
924274827 1:242375122-242375144 CTTGGTAGGGACAGGCTGGATGG - Intronic
924539905 1:244970774-244970796 CGAGGGAGGGGGAAGGAGGACGG - Exonic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924718740 1:246603766-246603788 CTAGGGAGGCAGTAGGGGGATGG + Intronic
1063594970 10:7426410-7426432 CCAGGTAGGAACATGGTGGAAGG - Intergenic
1063937134 10:11089648-11089670 CGAGGTAGAGAGAAGGCAGAAGG + Intronic
1064005798 10:11697988-11698010 CTTAGGAGGGAAAAGGTGGAAGG - Intergenic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064526300 10:16260353-16260375 GAAGGGAGGGAGAAGGTAGAAGG + Intergenic
1065567699 10:27031518-27031540 CTAGGATTGGAGAAGGTGGAGGG + Intronic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1065910190 10:30296510-30296532 CTTGGTAGGGAGAAGGTTGGGGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066393263 10:34995872-34995894 CTAGGTAGGGAAAAGGTCTGTGG + Intergenic
1067218981 10:44328237-44328259 CTAGGTAGGTTGAAAGTGAAAGG + Intergenic
1068260424 10:54573844-54573866 CTAAGTAAGGATAAGGTGCAGGG - Intronic
1068452787 10:57213129-57213151 CGAGGGAGGGACAAGGTGGGAGG - Intergenic
1069824068 10:71244586-71244608 CTAGCCGGGGAGCAGGTGGAAGG + Intronic
1070487192 10:76942382-76942404 TTTGGCAGGGAGTAGGTGGAGGG + Intronic
1071514436 10:86287853-86287875 CTAGGATGGCAGAAGGTGGCTGG + Intronic
1072229068 10:93398227-93398249 CCAGGCAGGGAGAAGGGCGATGG - Intronic
1073525885 10:104181608-104181630 CGAGCTAGGGAGAAAGTGGTGGG - Intronic
1073788434 10:106915504-106915526 ACAGGTAGGGAGGAGGAGGAGGG - Intronic
1074355797 10:112781982-112782004 CTAGGAAAGGAGATGCTGGAAGG - Intronic
1074441428 10:113480435-113480457 TTAGGTAGGAAGAAGGAGAATGG + Intergenic
1074460556 10:113633052-113633074 CAATGTGGGGAGACGGTGGAGGG - Intronic
1074811898 10:117113274-117113296 CTAGAGAGGGAAAAGGTGAAGGG + Intronic
1075155916 10:119975629-119975651 CCAGGCTGGGAGAAGATGGAGGG + Intergenic
1075404049 10:122182758-122182780 CTAGATAGGGAGAAGAGTGAGGG + Intronic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1076091545 10:127690428-127690450 GAAGGTGGGAAGAAGGTGGAAGG + Intergenic
1076996356 11:299234-299256 CAAGGTGGGGGGAAGGGGGAGGG - Intronic
1077491951 11:2865074-2865096 CTAGGGCGGGAGAAGGCGGCTGG - Intergenic
1078625031 11:12947687-12947709 CAAGATAGGGATAAGGTAGATGG - Intergenic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079045692 11:17100665-17100687 GTAGGAAGGGGGATGGTGGATGG - Intronic
1080474508 11:32577090-32577112 CAAGGTAGGAAGAAGGGGAAAGG + Intergenic
1083176238 11:60951864-60951886 CGAGGAAGGGTCAAGGTGGAGGG - Intronic
1083679077 11:64343009-64343031 CTTGGTGGGAAGAAGATGGAAGG + Intronic
1083683831 11:64364250-64364272 CCAGGTAGGGAGCAGGAGGAAGG + Intronic
1083853461 11:65380679-65380701 CTAGGCAGTGGGCAGGTGGAGGG - Intronic
1084014302 11:66369536-66369558 CCAGGTGGGGAGGTGGTGGAGGG + Intronic
1085095344 11:73755817-73755839 GAAGGAAGGGAGAAGGGGGAAGG + Intronic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1085350066 11:75792556-75792578 CCAGGAAGGGAGTAGGTGGGCGG - Intronic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1086199407 11:84183399-84183421 TTAGGTGGGGAGGAGGTGTATGG + Intronic
1088483514 11:110319354-110319376 CTAGGTAGGGATCAGGTAGAGGG + Intergenic
1088506764 11:110534824-110534846 CTAGGCAGGAAGAAGGAGAAAGG + Intergenic
1088750686 11:112839860-112839882 CCAGGCAGTGAGAAGGTGGGGGG + Intergenic
1089129171 11:116198948-116198970 CTGGGTAGAAAGAAGTTGGAGGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090203282 11:124870766-124870788 GTAGGAGGGGAGAAGGAGGATGG + Intronic
1090401749 11:126453681-126453703 CTGGGAAGGGAGGAGGCGGAGGG - Intronic
1091440941 12:511527-511549 GAAGGAAGGTAGAAGGTGGAAGG - Intronic
1091441320 12:513096-513118 GAAGGAAGGCAGAAGGTGGAAGG - Intronic
1092730521 12:11529170-11529192 CTAGGTAGGTTGAAAGTGAAAGG - Intergenic
1093456647 12:19371458-19371480 CTCAGAAGGGAGAGGGTGGAAGG - Intronic
1094174786 12:27530287-27530309 CTGGGAAGTGAGAGGGTGGAAGG + Intronic
1096229876 12:49890875-49890897 TGAGGTAGGGAGAAGGGGAATGG - Intronic
1096752194 12:53767773-53767795 TCTGGTAGGGAGAAGGTGTAGGG + Intergenic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1097052381 12:56231111-56231133 CTCGGTGGGGAGCAGGTGCAAGG + Intronic
1097220364 12:57446600-57446622 CTACGGAGGGCTAAGGTGGAAGG - Intronic
1097240962 12:57575003-57575025 ATGGGTAGGTAGAAGGTGGGAGG + Intronic
1100263884 12:92957795-92957817 CAATGGAGGGAGAAGGGGGAGGG - Intergenic
1100358521 12:93854730-93854752 GCAGGTAGTGAGCAGGTGGAAGG - Intronic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1101048078 12:100831696-100831718 TTAGGTTGTGATAAGGTGGAAGG + Intronic
1102682282 12:114698859-114698881 CCAGGGAGGGGGAAGGGGGACGG - Intergenic
1104104172 12:125643315-125643337 CTAGGTAGAGAGAAGAAAGAGGG - Intronic
1104769764 12:131354049-131354071 CCAGGGAGGGAGCAGCTGGAAGG + Intergenic
1105282907 13:18979499-18979521 CTAGGCAGAGAATAGGTGGAAGG - Intergenic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1106781045 13:33059437-33059459 CTAAGGAGGGAGAATGTGGAAGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108606924 13:52048816-52048838 TGGGGTTGGGAGAAGGTGGAAGG + Intronic
1109473624 13:62846908-62846930 AGAGGCAGGGAGAAGGAGGATGG - Intergenic
1109716166 13:66225359-66225381 CAAGGCAGAGAGAGGGTGGAGGG - Intergenic
1110214859 13:73014079-73014101 CTAGGGAGGAAAAAGGGGGAGGG - Intronic
1110330970 13:74271877-74271899 CTAGCTAGGAAGAAGGGTGAAGG + Intergenic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1113746274 13:112747051-112747073 CTAGGTATGGAACAGGTAGAGGG + Intronic
1114486044 14:23062281-23062303 GGAGGAAGGGAGAAGATGGAGGG + Intronic
1115736576 14:36338100-36338122 ATAGGTAGGGTGGTGGTGGAAGG - Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116466591 14:45240443-45240465 GTAGGTAGGGAGAAAATTGAGGG - Intronic
1117062823 14:51980594-51980616 TTAGGCAGGGAGAAAGAGGAAGG + Intergenic
1117938488 14:60935288-60935310 CTAGGTAGGTAGATGAGGGAGGG - Intronic
1118855405 14:69617847-69617869 CAAGGTAGGGAGGAGGGAGAGGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119330794 14:73792105-73792127 CTAAGGAGGGAGAATCTGGAAGG - Intergenic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1121432867 14:93899860-93899882 CTAGGGAGGGAGAGGGAGGAGGG + Intergenic
1121467990 14:94128301-94128323 CTGGGTAGGGAGAAGAGGAAAGG - Intronic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1121732379 14:96195448-96195470 CTTGGGAGGGGGAAGGTGCAGGG + Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1124484763 15:30104155-30104177 CTTGGGTGGGAGAAGGCGGAGGG + Intergenic
1124518819 15:30393083-30393105 CTTGGGTGGGAGAAGGCGGAGGG - Intronic
1124539837 15:30573163-30573185 CTTGGGTGGGAGAAGGCGGAGGG + Intergenic
1124758814 15:32434419-32434441 CTTGGGTGGGAGAAGGCGGAGGG - Intergenic
1126280196 15:46938508-46938530 TTGAGTAGGGAGAAGGTGTAAGG - Intergenic
1128351951 15:66896844-66896866 CTAGGTAGGAGAAAGGAGGAGGG + Intergenic
1128568615 15:68717429-68717451 ATAGGTGGGGAGAAGGAAGACGG + Intronic
1129224997 15:74164199-74164221 CAAGGTAGAGAGGAGCTGGAGGG - Intergenic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1129504501 15:76070257-76070279 CCAGTTAGGAAGAAGGAGGAAGG + Intronic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1130654964 15:85786195-85786217 GTAGGTAGGGGGAAGGGAGAGGG - Intronic
1130826077 15:87547607-87547629 CTAGGGAGGGAGGAGGTAGCAGG + Intergenic
1131131120 15:89901117-89901139 CAAGGTAGGGGGAAGGTACAAGG + Exonic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1132232470 15:100194148-100194170 CTAGGTGGGGTGACAGTGGAAGG - Intronic
1132306781 15:100820788-100820810 TTAGGTGGGGGGATGGTGGAAGG - Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132627927 16:901061-901083 CCAGGTAGGGAGTCGGGGGAGGG + Intronic
1133336580 16:5010565-5010587 CCCGGTGGGGAGAGGGTGGAGGG + Intronic
1133520231 16:6549388-6549410 CGAGGGAGGGAGGAGGAGGAGGG + Intronic
1133715414 16:8442703-8442725 CTCGGCAGGTGGAAGGTGGAAGG + Intergenic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134552652 16:15145161-15145183 CAAGGTAGGAAGAGGGTGGTGGG + Intergenic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138227700 16:55311975-55311997 GTGGGTAGGGAAAAGGGGGAAGG - Intergenic
1138293864 16:55870337-55870359 AGAGGAAGGGAGAAGGAGGAAGG + Intronic
1139404363 16:66706573-66706595 CCATGGAGAGAGAAGGTGGAGGG - Intergenic
1139743200 16:69053263-69053285 CTAAATAGGGAGAATGGGGAGGG - Intronic
1139982708 16:70872683-70872705 GTGGGTAGGGAGATGATGGATGG - Intronic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1141284728 16:82660989-82661011 CCAGGAGGGGAGAAGGTGGTGGG - Intronic
1141802359 16:86319478-86319500 CTAGGGCAGGAGGAGGTGGAAGG - Intergenic
1142479074 17:207084-207106 CGAGGAAGGTAGAAGGTGGTGGG + Intergenic
1143161297 17:4873177-4873199 ATATCTAGGGAGAATGTGGATGG - Intronic
1143863985 17:9910832-9910854 CTAGGCAGCCAGAGGGTGGAAGG + Intronic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147714150 17:42492770-42492792 CTTTGTGGGGACAAGGTGGAAGG + Intronic
1148384240 17:47222849-47222871 GTTGGTGGGGAGAAGGTGGGTGG - Intronic
1148732909 17:49848453-49848475 CCAGGTAGGGAGAAGGCATATGG - Intergenic
1151116592 17:71742554-71742576 CTAGAAAGGGAGAGGGTGGGAGG + Intergenic
1151383520 17:73741492-73741514 TGAGGACGGGAGAAGGTGGAAGG + Intergenic
1151441699 17:74133474-74133496 CTAGGTAGGGTGGAGGGGGCAGG + Intergenic
1152069568 17:78128140-78128162 CTAGGTGGGGAGAGGCTGGGTGG + Intronic
1152201836 17:78951963-78951985 CTAGGAAGGGAGGAGAGGGAGGG - Intergenic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152468763 17:80479126-80479148 CTAGGTCGGAAGAGGGGGGATGG + Intergenic
1153410178 18:4783652-4783674 CGAGGGAGGGACAAGGTGGGAGG + Intergenic
1153482260 18:5558545-5558567 TTAGGTATGTAGAAGGTGCATGG + Intronic
1153515521 18:5897046-5897068 ATAGGTAGGGGGAAGGCGGTGGG - Intergenic
1153762447 18:8344907-8344929 GGAGGTAGGGAGAGGGAGGAGGG + Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1155859344 18:30877395-30877417 CTATTTAGGGAGAGAGTGGATGG + Intergenic
1156194742 18:34761465-34761487 ATGGGTAGGGAAAAGGTGGAAGG + Intronic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157572665 18:48723403-48723425 GCAGGTGGGGAGAAGGTGGGAGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158494287 18:57940183-57940205 CAACGTAAGGTGAAGGTGGATGG - Intergenic
1158641832 18:59210371-59210393 CAAGGCAGGAAGAAGGTAGAAGG + Intergenic
1159651846 18:70987099-70987121 CAAGGGAGGGAGCTGGTGGAAGG + Intergenic
1160150185 18:76392520-76392542 CCAGGTGGGGGAAAGGTGGATGG + Intronic
1160150235 18:76392660-76392682 CCAGGTGGGGGAAAGGTGGATGG + Intronic
1160150247 18:76392695-76392717 CCAGGTGGGGGAAAGGTGGATGG + Intronic
1160150259 18:76392730-76392752 CCAGGTGGGGGAAAGGTGGATGG + Intronic
1160150271 18:76392765-76392787 CCAGGTGGGGGAAAGGTGGATGG + Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1162861301 19:13507316-13507338 CTAGAGAAGGAGGAGGTGGAGGG - Intronic
1163206054 19:15803472-15803494 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic
1163820481 19:19493748-19493770 CTAGGTAGGTGTAAGGTGGGGGG - Intronic
1165147253 19:33738931-33738953 CTAGAGAGGGAGATGGTGGGTGG + Intronic
1165386578 19:35513683-35513705 CTAGGTTGGGAGAAGGTGACAGG + Intergenic
1165543492 19:36512503-36512525 CTAGGAAGAAAGGAGGTGGAAGG - Exonic
1166174809 19:41059753-41059775 ATAGGAAGGTGGAAGGTGGAGGG + Intergenic
1168149611 19:54438048-54438070 CTGGGTAGGGAAAATGGGGAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925847117 2:8044222-8044244 AGAGGAAGGGAGAAGGAGGAAGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
928247997 2:29648283-29648305 CTAGGAAGGGAGAATTAGGAGGG - Intronic
928308829 2:30193469-30193491 CTAGGGAGGCAGCAGGGGGAGGG - Intergenic
928443383 2:31312063-31312085 CTAGGAAGGGAGGAGATGGAGGG - Intergenic
928945157 2:36765540-36765562 CAAGGGAGGGATGAGGTGGAAGG - Intronic
929318763 2:40514289-40514311 CTGGGAAGGAAAAAGGTGGAAGG - Intronic
930986806 2:57598924-57598946 ACAGGTATGGAGAAGGTGAAAGG + Intergenic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931765595 2:65453269-65453291 CTGGGAAGGAAGAAGGTAGAAGG + Intergenic
932585087 2:73022618-73022640 GTAGGGAGGGGGAAGGGGGAAGG + Intronic
933594432 2:84268342-84268364 TGAGGTAGGGGGAGGGTGGAGGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935836579 2:107061769-107061791 AGAGGGAGGGAAAAGGTGGAAGG - Intergenic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
937160304 2:119754853-119754875 CTAGGTTTGAAGATGGTGGAAGG + Intergenic
937554818 2:123141035-123141057 TGTGGTAGGGAGAAGGGGGAGGG - Intergenic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
938380015 2:130831427-130831449 CCAGGCTGGGAGAAGGTGGAAGG - Intergenic
938969559 2:136419837-136419859 CCAGGCAGGGAGAAGGGAGACGG - Intergenic
939442290 2:142264488-142264510 CCAGGGAGGGAGAAGGTGTTTGG + Intergenic
940481656 2:154240729-154240751 CAAGGTAGTGACAAGGTAGAGGG - Intronic
942504665 2:176628950-176628972 GTAGGTAGTGAGGAGGTGGGTGG - Intergenic
943313526 2:186357015-186357037 CTACTTAGGGATAAGGTGGAAGG + Intergenic
944315939 2:198285882-198285904 CTAGGTAGGGGGAGGGTGAAGGG + Intronic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
947526197 2:230878162-230878184 CTAAGCAGGGGGAAGGAGGAGGG - Exonic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948363951 2:237442591-237442613 CTCTGTAGGGAGAGGGAGGAAGG + Intergenic
948657641 2:239486583-239486605 GCAGGTAGGGAGAGGGTGGTGGG - Intergenic
1168806887 20:676767-676789 CTGGGAAGGGAGAGGGGGGAAGG + Intergenic
1168857642 20:1019879-1019901 ATAGGTGGGTAGATGGTGGATGG - Intergenic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1171451264 20:25237620-25237642 GTAGGGAGGAAGATGGTGGACGG + Intergenic
1174439731 20:50540956-50540978 CTAGGGACTGAGCAGGTGGATGG - Intronic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1175011179 20:55738326-55738348 CTCGGAAGGGGGAAGATGGAGGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178992073 21:37365614-37365636 ATAGCTAGGGAGAAGGGGTAGGG + Intergenic
1179003328 21:37484207-37484229 GTAGGTAGGGGTGAGGTGGATGG - Intronic
1179628531 21:42662344-42662366 ACAGGTAGGGGGAGGGTGGATGG - Intronic
1179884984 21:44309996-44310018 CTGGTTGGGGAGAAGGCGGAGGG + Intronic
1180299266 22:11023789-11023811 CTAGATAGGCAGATAGTGGAGGG - Intergenic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181574685 22:23786434-23786456 AGAGGAATGGAGAAGGTGGAAGG + Intergenic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1182109104 22:27710427-27710449 CCAGATACGGAGAAGGTGCAAGG - Intergenic
1183734128 22:39634542-39634564 CTGGGAGGGGAAAAGGTGGAGGG - Intronic
1184212519 22:43044188-43044210 CTAGGTACAGAGAAGGCAGAGGG - Intronic
1184389231 22:44193377-44193399 GTAGGGAGGGAGAGGATGGAAGG + Intronic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
949590889 3:5492972-5492994 CTAGGAAGGGAGAGGAGGGAAGG - Intergenic
949591366 3:5497463-5497485 CTAGGAAGGGAGACGAAGGAAGG - Intergenic
949913414 3:8935608-8935630 CTATCTAGGGAGAATGTGGTGGG - Intronic
951782588 3:26380824-26380846 CCAGGTAGGGAGATGGGTGAGGG + Intergenic
952384827 3:32832778-32832800 CTAGGAAGGGAGGAAGAGGAGGG - Intronic
953106404 3:39884929-39884951 ATAGGGAGGGAGAAGGGGGGTGG - Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
958446237 3:94218508-94218530 CAAGGAAGGGAGAAAGTGAAAGG + Intergenic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959577135 3:107946663-107946685 CAAGGGAGGGACAAGGTGGGAGG - Intergenic
961265049 3:125634921-125634943 CTTGGTGGGGAGAAGGAAGATGG + Intergenic
962859808 3:139389378-139389400 CCAGGAAGGGAGAAGGCGGTGGG - Intronic
963507613 3:146206720-146206742 CTGGGTAGCCAGTAGGTGGAGGG + Exonic
963812990 3:149797837-149797859 CTAGGTAGGGAATCGGGGGAGGG + Intronic
964433317 3:156627144-156627166 CTAGCTAGCAAGAAGGTGGAAGG + Intergenic
966208854 3:177432533-177432555 CAAGTTGGGGAGAAGGTTGATGG - Intergenic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968805591 4:2769850-2769872 CTAGATAGGGAGAACAAGGAGGG + Intergenic
968881670 4:3303326-3303348 CTAGGCAGGGAGGATGTGGGAGG + Intronic
969033153 4:4229182-4229204 AGAGGAGGGGAGAAGGTGGAGGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
970007031 4:11421345-11421367 CTGGGTAGGAAGGAGGGGGAGGG - Intronic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
971611288 4:28730359-28730381 CTAGGGAGGGTGTAGGTGGAAGG - Intergenic
972632704 4:40856209-40856231 CTTGGGTGGGAGAAGGCGGAAGG - Intronic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
973852024 4:54970281-54970303 TTAGGTAGGGAGAAAGTGAGAGG + Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
979704238 4:123702098-123702120 CTAGGAAGGGAGAAGATAGAAGG + Intergenic
980277498 4:130673667-130673689 CTAGGGAGGGAGGAAGTGGAGGG - Intergenic
981725469 4:147842830-147842852 CAAGGAAGGGAAAAGGTGGGTGG - Intronic
982644659 4:158008726-158008748 CTCAGGAGGGAGAAGCTGGAAGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984349390 4:178570849-178570871 CAAGGTAGTGAGAATGAGGAGGG + Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985511854 5:317954-317976 CAGGGTTGGGAGTAGGTGGAGGG - Intronic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
987798623 5:22664336-22664358 CTATCTAGGAAGAAGGTGAAGGG + Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
990727677 5:58774658-58774680 CTAGGGAGGGAGAGGGAGTAGGG + Intronic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
990915427 5:60898074-60898096 CTAAGTAGGGAGAATGTGGTAGG + Intronic
991554662 5:67881960-67881982 CTACGTAGGGAGATGATGAAAGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
993086591 5:83370590-83370612 CAAGGTAGGCTAAAGGTGGAAGG - Intergenic
994086224 5:95762230-95762252 CCAGGTGGGGAGAAGTTGAAAGG + Intronic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994713084 5:103289840-103289862 CTGAGAAGGGAGAAGATGGAAGG - Intergenic
995354780 5:111224742-111224764 CTAGGTAGGGAGAAATCGAAGGG - Intronic
995525183 5:113045025-113045047 GTAGGTGGAGAGGAGGTGGAAGG - Intronic
996059972 5:119022420-119022442 CCAGATAGGGAGAACGTTGAAGG + Intergenic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999372336 5:151063643-151063665 CCAAGGAGGGAGAAGGTGGTGGG + Exonic
1000015164 5:157269275-157269297 GTAGGTAGGGAGAAGTGGGAGGG + Intronic
1000096536 5:157975995-157976017 CTAGGTATGTGGGAGGTGGAGGG + Intergenic
1000348528 5:160334179-160334201 CGAGGCAGTGAAAAGGTGGAGGG - Intronic
1000474322 5:161686433-161686455 CTAGGTAGTGGGAAGGGGCAGGG + Intronic
1000780687 5:165476901-165476923 CTAGGTAGAGAGAGAGTGAATGG + Intergenic
1001189537 5:169615577-169615599 CAAGGGAGGGACAAGGTGGGTGG + Intergenic
1001303137 5:170552556-170552578 ACAGGTAGGGGGAAGATGGAAGG + Intronic
1001439922 5:171734819-171734841 CAAGCAAGTGAGAAGGTGGAAGG - Intergenic
1001642279 5:173252910-173252932 CTAGGGAGGGACCTGGTGGAAGG - Intergenic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1006307885 6:33235587-33235609 TTAGGGAGGGGGAAAGTGGAGGG + Intergenic
1006511898 6:34526022-34526044 CCAGGGAGGGGGAAGGAGGAGGG + Intronic
1006900592 6:37498426-37498448 CTTGGTAGGAAAAAGGTTGATGG - Intronic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007475436 6:42116710-42116732 GTAGGTGGGGAGAAGATGGTAGG - Intronic
1007663919 6:43503324-43503346 CCAGGATGGGAGGAGGTGGAGGG + Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008453312 6:51678780-51678802 GAAGGTAGAGAGAAGGTGTAGGG - Intronic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1011763628 6:90594928-90594950 ATAGTTTGGGAGAAGGTAGAAGG + Intergenic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1013278882 6:108615954-108615976 CTATGTAGTAAGAAGGTAGAGGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1016448721 6:144158916-144158938 CTTGGTAGGGAGAAGGGAAAGGG - Intronic
1016893137 6:149026720-149026742 CTAGGAAGGGAGAAGGTAATGGG - Intronic
1017395123 6:153990006-153990028 CTATATAGGCAGAAGGTTGAAGG - Intergenic
1017515798 6:155154736-155154758 CTGGGGAGGGAGGAGGTGGTTGG + Intronic
1018911033 6:168101105-168101127 GGAGGTAGGGAGGAGGTGGGAGG + Intergenic
1019358807 7:594507-594529 CTAGGTAAGGACAGAGTGGAGGG + Intronic
1019557722 7:1641005-1641027 CTGGGAAGAGAGGAGGTGGAGGG - Intergenic
1019796286 7:3051260-3051282 GCAGGAAGAGAGAAGGTGGAGGG + Intergenic
1020785831 7:12571129-12571151 TTCGGTAGGGAGAAAGTGGCCGG - Intronic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1023829359 7:44029815-44029837 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1024991231 7:55235732-55235754 CTAGGTGGGAAGAAGGGGGCAGG - Intronic
1026070992 7:67119476-67119498 CTCAGAAGGGAGAAGGTGGTGGG - Intronic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1027432823 7:78132200-78132222 GGAGGTAGGGAGAATGTTGAAGG - Intronic
1029739665 7:102484073-102484095 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029757666 7:102583252-102583274 ACGGGGAGGGAGAAGGTGGAAGG - Intronic
1029775602 7:102682313-102682335 ACGGGGAGGGAGAAGGTGGAAGG - Intergenic
1029997465 7:105021640-105021662 CTAGTTAGAGAGATGGTGGTGGG + Intronic
1030172410 7:106616542-106616564 GTAGGTATGGAGAGGGTGGGAGG + Intergenic
1030361090 7:108596107-108596129 CTAGGTATGGATACTGTGGAAGG + Intergenic
1030715846 7:112805949-112805971 CTAAAGAGGCAGAAGGTGGAGGG - Intergenic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031998128 7:128246245-128246267 TTAGGGAGGTAGGAGGTGGAGGG + Intronic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032453383 7:132053601-132053623 CTAGGTAGGGTGGAGTGGGATGG + Intergenic
1033659532 7:143393960-143393982 CTAGGATGGGAGGAGGTGGGAGG + Intronic
1034447746 7:151122174-151122196 CCAGGGAGGAGGAAGGTGGATGG - Intronic
1035038047 7:155908162-155908184 AGAGGTAGGGAGAAGGGGGAGGG + Intergenic
1035671950 8:1424869-1424891 CTGGGGAGGGAGAATGAGGAGGG + Intergenic
1036008943 8:4698710-4698732 GAAGGAAGGGAGAAGGTGGAAGG - Intronic
1036037269 8:5032575-5032597 GAAGGAAGGGAGAGGGTGGAGGG + Intergenic
1037169396 8:15873868-15873890 GTAGGAAGGGGGAAGGGGGAGGG - Intergenic
1037712391 8:21365307-21365329 CTTGGAAGGGTGGAGGTGGATGG - Intergenic
1037900522 8:22685619-22685641 TGAAGTAGGGAGAAGGTGGAGGG - Intergenic
1038680331 8:29661203-29661225 CTAGGCAGGGAGGCGGTGGGTGG + Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1043936424 8:86147862-86147884 GGAGGTAGCGAGAAGATGGAGGG + Intronic
1044500118 8:92944702-92944724 CTAGCAAGGGAAAAGGAGGAGGG + Intronic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045342240 8:101265407-101265429 CTGGGTAGGGGGAAGCTAGATGG + Intergenic
1045402785 8:101835342-101835364 CTGGTTTGGCAGAAGGTGGAGGG - Intronic
1047907030 8:129483199-129483221 GGAGGAAGGGAGAAGGGGGAAGG + Intergenic
1048144727 8:131830128-131830150 GTAGGAAGGGAGAAGAGGGAGGG + Intergenic
1048704103 8:137131058-137131080 CTAGGTAGGGAGATAATGGTAGG + Intergenic
1048986553 8:139738027-139738049 CTGGCTTGGGAGAAGCTGGAAGG - Intronic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050490859 9:6186551-6186573 GGAGGGAGGGAGAAGGTGAAGGG + Intergenic
1051174459 9:14348433-14348455 CTATTTCGGGAGAAGTTGGAGGG + Intronic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051758680 9:20435631-20435653 CTATGTAGGCAGAAAGTGGGAGG + Intronic
1057387144 9:94614200-94614222 GGAGGGAGGGAGAAGGGGGAGGG + Intronic
1059528512 9:115015189-115015211 CTAGGGAGGGAGGAGGATGAGGG + Intergenic
1059713784 9:116894250-116894272 GTAGGTAGGGACAGGGTGGATGG + Intronic
1059758267 9:117313953-117313975 TTAGGAAGGGAGAAGTGGGAAGG - Intronic
1060258531 9:122053622-122053644 CTAGGCTGGGAGAAAGGGGAGGG + Intronic
1060435439 9:123588718-123588740 GTAGGAAGGGAGAATATGGAAGG - Intronic
1060468316 9:123927727-123927749 GGAGGTAGGGACAAGGGGGAGGG - Intronic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061859638 9:133461245-133461267 CCAGGTGGGTAGAGGGTGGAGGG + Intronic
1061905018 9:133692294-133692316 CTAGCTAGGGAGACAGTAGAGGG - Intronic
1062030103 9:134358366-134358388 CTGGGTAGGGTGGAGCTGGAGGG + Intronic
1186096823 X:6111317-6111339 GTTGGAAGGGACAAGGTGGAAGG - Intronic
1186478300 X:9876479-9876501 CTAGGAATGGAGAAAGAGGAGGG - Intronic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188483274 X:30655387-30655409 CCAGGCAGGTAGAAGGGGGAAGG + Intronic
1191958440 X:66672465-66672487 GTAGGTAGGGAGAGGGTGAAAGG + Intergenic
1192035161 X:67554988-67555010 CTAGGAAGAGATAAGGTGAAAGG + Intronic
1192582909 X:72299636-72299658 CTAGGAAGGGAGAGGAAGGAGGG - Intronic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1194695104 X:97037995-97038017 GTAGGTTGGGAGAAGGATGAGGG - Intronic
1196048748 X:111282921-111282943 CAAGGTAGGGAGAATATGGAGGG - Intergenic
1196832774 X:119789191-119789213 GTAGGTAGGGAGAGGTTGCAGGG + Intronic
1197339076 X:125243787-125243809 GTATGTAGGGAGTAGGTAGAAGG + Intergenic
1198471079 X:136947593-136947615 CTAGTTAGGGGGAGGGTGCAAGG + Intergenic
1199361180 X:146920808-146920830 GTAGCTAGGTAGAAGATGGATGG - Intergenic
1199512694 X:148640373-148640395 GGAGGGAGGGAGAAGGTAGAAGG - Intronic
1199749512 X:150801526-150801548 CTAGGGAGGGACCTGGTGGAAGG - Intronic
1200135784 X:153873925-153873947 CGAGGAAGGGAGAAGAGGGAGGG + Intronic
1201146321 Y:11067183-11067205 GGAGGGAGGGAGAAGGGGGAGGG + Intergenic