ID: 967220104

View in Genome Browser
Species Human (GRCh38)
Location 3:187241524-187241546
Sequence CCAGACTCCTTGGGCAGAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967220100_967220104 -7 Left 967220100 3:187241508-187241530 CCAATACTTTATTCATCCAGACT 0: 1
1: 0
2: 2
3: 17
4: 181
Right 967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 176
967220099_967220104 -6 Left 967220099 3:187241507-187241529 CCCAATACTTTATTCATCCAGAC 0: 1
1: 0
2: 0
3: 17
4: 169
Right 967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 176
967220098_967220104 -5 Left 967220098 3:187241506-187241528 CCCCAATACTTTATTCATCCAGA 0: 1
1: 0
2: 0
3: 19
4: 175
Right 967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 176
967220097_967220104 21 Left 967220097 3:187241480-187241502 CCTGGAAGGCAGGTGGGTAGGCT 0: 1
1: 0
2: 2
3: 25
4: 266
Right 967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG 0: 1
1: 0
2: 0
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967220104 Original CRISPR CCAGACTCCTTGGGCAGAAC AGG Exonic
900915136 1:5632277-5632299 CCTGACCCCTGGGGCAGAGCCGG - Intergenic
901238943 1:7681840-7681862 CCAGTGTCCTTGGCCAGAAGAGG - Intronic
901880593 1:12191610-12191632 CCAGAGTCCAGGGGCAGGACCGG - Intronic
903175351 1:21577188-21577210 GCAGACTCCTGTGTCAGAACAGG + Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
903971012 1:27118816-27118838 ACAGACTGCTGGGGTAGAACTGG - Intronic
905366864 1:37456907-37456929 CCTGGCTCCAAGGGCAGAACTGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
907831694 1:58070465-58070487 CCAGACACCTGGGGCAGGAGCGG + Intronic
915005105 1:152628512-152628534 CCCCACTCCTGGGCCAGAACAGG - Intergenic
915785342 1:158605565-158605587 CCAAATTCCTTGGGCAGAGTAGG - Intergenic
915881201 1:159673403-159673425 CCAGCCTTCTTGGGGAGAAGAGG - Intergenic
915935446 1:160087828-160087850 CCAGACCCCTGTGGCAGACCGGG + Exonic
916166291 1:161969768-161969790 CCAGGCTCCATGGGCAGAGTTGG + Intergenic
916859390 1:168786658-168786680 CCAGTGTCATTGGGCAGAAGGGG - Intergenic
917237409 1:172909330-172909352 CCAGACTTTTTGGGCAGAATAGG + Intergenic
917467073 1:175289210-175289232 CAAGACTCCTTGTGCAGAAAAGG - Intergenic
919989402 1:202698678-202698700 CCAGACTCACCAGGCAGAACAGG + Intronic
923392602 1:233529015-233529037 ACAGATTCCTTGGTCAGAATGGG + Intergenic
1063593269 10:7411603-7411625 CCAGGCCCCTTGGGCAGGGCTGG + Intergenic
1064156812 10:12909436-12909458 CCACACTCCATGGGCAGGGCAGG - Intronic
1069753462 10:70759787-70759809 CCAGACTCCTTGGGTTGATTGGG + Intronic
1072662392 10:97370882-97370904 CCAGGCTCCCTCGGCAGAGCGGG + Intronic
1073009588 10:100348866-100348888 CCTGACCCCTTGGCCAGACCAGG + Intronic
1075576692 10:123582846-123582868 CCAGAGTCCTTCAGCAGAGCTGG - Intergenic
1075583169 10:123637648-123637670 CCAGACTCCTGGGGCCCCACTGG - Intergenic
1076924620 10:133476078-133476100 CTAGCCTCCTCGGGCAGGACAGG - Intergenic
1077241982 11:1515468-1515490 CCAGCTACCTGGGGCAGAACAGG - Intergenic
1080287250 11:30629612-30629634 TCAGTCTCCTTGGGCTGAAGTGG + Intergenic
1081738741 11:45423490-45423512 TCAGACTCCTTGGGCACATTGGG - Intergenic
1083174196 11:60939103-60939125 CCAAGGTCCTTGGGCAGAAGGGG - Intronic
1085587502 11:77724253-77724275 CTAGAGTCCTTGGGCACTACTGG + Intronic
1085883472 11:80496079-80496101 CTAGATTCCTTGGGCAGACGGGG + Intergenic
1086288491 11:85276928-85276950 ACAGAGGCCTTGGGCAGTACAGG + Intronic
1088818892 11:113440476-113440498 CCAGGCTCCTGGGACAGAATGGG - Intronic
1089314173 11:117579397-117579419 GCCCACTCCTTGGGCACAACTGG + Intronic
1089325159 11:117651958-117651980 CCAGCCTCCTAGGGCAGCCCAGG + Intronic
1089360341 11:117881662-117881684 CTAATCTCCTTGGCCAGAACTGG - Intergenic
1091585556 12:1814275-1814297 TGAGGCTCCTTGGGCAGAAATGG + Intronic
1091596419 12:1881955-1881977 CCAGCCTCCTTTGTCAGCACAGG + Intronic
1096495058 12:52035076-52035098 TGAGACTCCTAGGGCAGAGCAGG + Intronic
1096760617 12:53839074-53839096 CCTGACTCCTTGGGCAGTTCTGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097684369 12:62677701-62677723 CCAGGCTGAGTGGGCAGAACAGG + Intronic
1100711898 12:97266162-97266184 CCATACTCAATGGGCAGACCTGG + Intergenic
1107878038 13:44807627-44807649 CCAGACTGCCTGAGCAGAATGGG - Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1110168631 13:72473905-72473927 CCAGACCCCTTGGCAAGGACTGG + Intergenic
1117950223 14:61075422-61075444 CCAGAGTCCGTGGGCACATCAGG + Intronic
1118838590 14:69494462-69494484 CCATACTCCTAGGGCAGAGGTGG - Intronic
1119150050 14:72350505-72350527 TCACAATCCTTGGCCAGAACTGG - Intronic
1121180102 14:91922512-91922534 CCAGCCTCCATGGGGAGAAGTGG + Intronic
1121421566 14:93819217-93819239 CCAGACCCCTTGACCAGCACAGG + Intergenic
1121518525 14:94569981-94570003 CCAGACTCCCCTGGCAGACCTGG + Intronic
1122262763 14:100532524-100532546 CCAGGCTCCTTGGGCAGGTGTGG + Intergenic
1122873432 14:104651717-104651739 CCAGACACCCTGGGCACAACCGG + Intergenic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1124604414 15:31160183-31160205 CCAGTCTCCTTGGGCTCAAGTGG + Intronic
1125675001 15:41497134-41497156 CCTCACTCCTAGGGCTGAACAGG - Intronic
1126459788 15:48902748-48902770 GCAGACTCCATGGGCAGTTCTGG - Intronic
1127256767 15:57299588-57299610 CCAGCCTCCCTGGGCAGATCTGG - Intergenic
1127838476 15:62809795-62809817 CCTGACTCCCTGGACAGAAGAGG - Intronic
1128182217 15:65613936-65613958 CCAGACTACAGGGGCAGAAAGGG - Intronic
1128804034 15:70517495-70517517 GCAGACTCCCTGGGCAGGGCTGG - Intergenic
1129669929 15:77601938-77601960 TTAGACACCTTGGGCAGAAGAGG + Intergenic
1132774633 16:1586200-1586222 CCAGACTTCCTGGGCAGCCCCGG - Exonic
1132980760 16:2737745-2737767 CCAAACTCAGTGGGGAGAACAGG + Intergenic
1135164485 16:20126627-20126649 TCTGCCTCCTTGGGCAGATCTGG + Intergenic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1140194531 16:72845575-72845597 ACAGGCTCCTGGGGCAGGACGGG - Intronic
1140662240 16:77198663-77198685 CTAGACACCTTGGCCAGATCTGG - Exonic
1141700303 16:85639248-85639270 CCAGACTCCTCGGGTGGCACCGG + Intronic
1143014737 17:3885639-3885661 CCAGGATCCTCGGGCAGAGCTGG - Exonic
1143309789 17:5978720-5978742 CCAGAGTCCATGGGGACAACAGG + Intronic
1143746157 17:8995723-8995745 CCAGACTCCCTGGCCTGAAAAGG - Intergenic
1147264024 17:39224535-39224557 CCAGACTCCTGGCGCTGAAAGGG - Intronic
1147805157 17:43126065-43126087 CCAGACTCCTGGGGCTGGATGGG - Intergenic
1148550843 17:48550206-48550228 CCAGGCTTCCTGGTCAGAACCGG - Exonic
1149469199 17:56902261-56902283 CCAGATTCCTTGTTCAGATCAGG - Intronic
1149995796 17:61405395-61405417 CCAGGCTCCTCAGGCCGAACGGG - Exonic
1152041492 17:77906607-77906629 CCTTCCTCCTTGGGCAGACCAGG - Intergenic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1160512046 18:79458208-79458230 ACAGACTCCTGGGGGAGAGCCGG + Intronic
1160975843 19:1792019-1792041 CCAGCCTCCTGCTGCAGAACCGG - Exonic
1163384815 19:16993191-16993213 CAAGACTCCTTTGGCATAACTGG + Intronic
1164779650 19:30882185-30882207 CCAGCCTCTTAGGGCAGAATGGG - Intergenic
1165422493 19:35729144-35729166 CCCGCCTCCTGGGGCAGAAGAGG - Exonic
1167820944 19:51927289-51927311 CCTGAATACTTGGGCAGAAAAGG + Exonic
1168520299 19:57044914-57044936 GGAGCCTCCTTGGGCAGAATAGG - Intergenic
925177599 2:1796399-1796421 CCAGCCTCCCTGGTCAGCACGGG - Intronic
926812255 2:16765426-16765448 CCACACTGCTTGGGCACCACTGG + Intergenic
927522681 2:23709464-23709486 CCAGGCTCCCTGGGGAGAAAAGG + Intergenic
932319553 2:70811717-70811739 CCAGGCTTCTTGGGAAGACCAGG - Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934955213 2:98611725-98611747 CCAGACAACTTAAGCAGAACTGG - Intronic
935697821 2:105785350-105785372 CTAGCCTCCTTGGCCAGGACGGG - Intronic
936493146 2:112993086-112993108 CCAGAATCCTTTGGCAGCAGAGG + Intergenic
938262841 2:129907428-129907450 ACAGACTCTTGGGGCAGAGCGGG + Intergenic
944547099 2:200809966-200809988 CCAGACTGCTTGGGTTCAACTGG + Intergenic
945393544 2:209294709-209294731 GCAGACTCCTGAGGCAGCACAGG + Intergenic
947967120 2:234290857-234290879 CCAGACACCTTGGGAGGAAGTGG + Intergenic
1168809537 20:695432-695454 CCAGATTCCATGGGCAGAAGTGG - Intergenic
1170159156 20:13295102-13295124 CCAGGCTCCTGGGTCAGAGCTGG + Intronic
1172831850 20:37842630-37842652 CCAGACTCCCAGGTCAGACCTGG - Intronic
1173781046 20:45757939-45757961 CCAGACTACTTAGGGAGATCAGG + Intronic
1178391033 21:32198574-32198596 GCAGAAGCCATGGGCAGAACCGG - Intergenic
1178684818 21:34702590-34702612 CCAGCCTCCATGGGCAGGGCAGG + Intronic
1179250813 21:39669869-39669891 GCACACTCCTTGGGCAGGGCTGG - Exonic
1181756679 22:25029145-25029167 CCAGAGTCCCTGGGAAGAAAAGG + Exonic
1182364032 22:29766035-29766057 CAAGACTCCTTGGCCAGACGCGG + Intronic
1183403608 22:37619024-37619046 GAAGACTCCTTGGGCTGAGCCGG - Intronic
1185281256 22:49971081-49971103 CCAGCATCCTTGGACAGGACAGG - Intergenic
949334750 3:2962274-2962296 CCAGACGCCTGGTGCAGCACAGG + Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951140539 3:19153432-19153454 CCAGTCTCATTGGCCAGAAGAGG - Intronic
953124630 3:40078834-40078856 CCTGTCTCCTTCAGCAGAACGGG - Intronic
954198981 3:49013098-49013120 CCAGGGTCCTTGAGCAGACCTGG - Exonic
955659149 3:61278004-61278026 CCACAGTCCAAGGGCAGAACTGG + Intergenic
961203454 3:125062446-125062468 CCGGCATCCTTGGGCAGAGCTGG + Intergenic
963313229 3:143731117-143731139 CAAGTCTCATTGGCCAGAACTGG + Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
968737660 4:2305583-2305605 CCAGCCTCCTTGGCCAGGAGTGG + Intronic
969126432 4:4951678-4951700 ACAGACTCCTTGGGGAGATTTGG - Intergenic
972254407 4:37337628-37337650 CTTGTCTCCTTGGGCAGCACAGG + Intronic
972639958 4:40916450-40916472 CCAATCTCCATGTGCAGAACGGG - Intronic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
977822250 4:101487042-101487064 CCAGACTCCTTTGTCAGAAATGG - Intronic
980292093 4:130856937-130856959 CCATATTCCCTGGGCAGAAAAGG - Intergenic
981696982 4:147568791-147568813 CCAGTCCTCTTGGGCATAACTGG - Intergenic
981714197 4:147736837-147736859 CACGTCTCCTTGGTCAGAACTGG - Intronic
982390542 4:154858478-154858500 GCAGACTCTTTGAGGAGAACAGG - Intergenic
987946829 5:24620706-24620728 CCACACTTATAGGGCAGAACAGG + Intronic
996266762 5:121550620-121550642 ACTGATTCCTTGGGCAGAAGGGG - Intergenic
1002172829 5:177384994-177385016 CAAGACTCCTGGGGCAGTGCGGG + Intronic
1005397763 6:25400903-25400925 CCAGACTCATTGAGAAGACCAGG + Intronic
1006173780 6:32109830-32109852 CCAGACTGCCAGGGGAGAACTGG - Intronic
1006408843 6:33860355-33860377 CCAGACTCCCAGGGCAGAAAGGG - Intergenic
1006611736 6:35298163-35298185 GCAGAAACCTTGCGCAGAACTGG + Intronic
1007408776 6:41649651-41649673 CCAGAGTCATTCGGCAGAAGTGG - Exonic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011182096 6:84632623-84632645 CCTGACTGCTTGGGAAGCACAGG - Intergenic
1011954220 6:93005216-93005238 CCACACTCCTTGGCCAGCAGAGG + Intergenic
1013124783 6:107172362-107172384 CTAGTTTCCTTGGGCAGAAGTGG - Intronic
1013495135 6:110690328-110690350 CCAGACTACTGGGTCAGAAGTGG + Intronic
1015757540 6:136622660-136622682 CCAGACTGGTGGGGAAGAACGGG - Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1019117424 6:169776500-169776522 GCACAATCCTGGGGCAGAACAGG - Exonic
1019177370 6:170166963-170166985 TCAGGCTCCTGGGGCAGAGCTGG + Intergenic
1019626693 7:2019488-2019510 CCACCCTCCTTGTGCAAAACGGG + Intronic
1021185953 7:17565140-17565162 CCTGACTCCTTGTACAGACCTGG + Intergenic
1021241487 7:18207520-18207542 AAAGACTCCTTGGGCAGATGAGG - Intronic
1022661873 7:32375320-32375342 TCAGCCTCCATGAGCAGAACAGG + Intergenic
1023154621 7:37236197-37236219 ACAGACTCCTCAGACAGAACAGG + Intronic
1023302808 7:38792019-38792041 CCAGACTGCCTGGCCAGAGCTGG + Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026867008 7:73830211-73830233 CCAGCCTGCTTGCCCAGAACTGG - Exonic
1032146824 7:129390761-129390783 CGTGTCTCATTGGGCAGAACTGG + Intronic
1033003104 7:137529387-137529409 CCAGAATCATTGGCCAGAATAGG + Intronic
1034953349 7:155316399-155316421 CCACACTCCTTGGGAAGCAGGGG - Intergenic
1035244514 7:157553604-157553626 CCAGACAACATGGGGAGAACCGG + Intronic
1037920849 8:22804396-22804418 CCAGACTCCTTGCCCAGGCCTGG + Intronic
1037987035 8:23296465-23296487 CCACACTCCTTTGGCAGTTCAGG + Intergenic
1038722591 8:30050431-30050453 CCAAAGTCCTAGGGCAGAAATGG + Intergenic
1039669920 8:39584496-39584518 CCAGGGTCCTGGGGCAGCACAGG + Intronic
1040037407 8:42884040-42884062 CCAGGCGCAGTGGGCAGAACTGG - Intronic
1040560879 8:48522624-48522646 CCAACCACCCTGGGCAGAACAGG + Intergenic
1043520981 8:81044918-81044940 CCAGTCTCCCCGGGCATAACTGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1053519698 9:38765122-38765144 CAACACTCCTTGGGCACCACTGG + Intergenic
1055887748 9:81084608-81084630 CAAGATTAATTGGGCAGAACAGG + Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056943763 9:90976672-90976694 AGAGGCTCCTTGGGCAGAAGAGG - Intergenic
1057729518 9:97596570-97596592 CCACAATCCGTGGGCAGGACCGG + Intronic
1058899502 9:109430228-109430250 CCTGACTCGTTCTGCAGAACAGG - Intronic
1058962947 9:110008828-110008850 CCACACCCATTGGCCAGAACTGG - Intronic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1062235242 9:135504879-135504901 CCAGCCTCATTCAGCAGAACAGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191243318 X:58206442-58206464 CCAGACTCCTGGGGTAGGCCAGG - Intergenic
1192590034 X:72351945-72351967 GAGGCCTCCTTGGGCAGAACAGG + Intronic
1193909189 X:87280940-87280962 CCAGTCTTCTTGGGCAGACTCGG + Intergenic
1195840555 X:109172051-109172073 CCAGACTGAGTGGGCAGAATAGG - Intergenic
1196360937 X:114857186-114857208 ACAGAATCCTGGGGAAGAACGGG - Intronic
1197345224 X:125321266-125321288 ACAATCTCCTTGGGCACAACTGG - Intergenic
1197607109 X:128597476-128597498 CCAGACTGCTTGGTCACAAGAGG - Intergenic