ID: 967220494

View in Genome Browser
Species Human (GRCh38)
Location 3:187244156-187244178
Sequence CTGCCTGTAGAGAGGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 301}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967220494_967220503 12 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220503 3:187244191-187244213 TAGAAGCCAGGAGGCAGGGTTGG 0: 1
1: 0
2: 3
3: 84
4: 982
967220494_967220500 7 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220500 3:187244186-187244208 GGCCATAGAAGCCAGGAGGCAGG 0: 1
1: 0
2: 2
3: 25
4: 331
967220494_967220504 15 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220504 3:187244194-187244216 AAGCCAGGAGGCAGGGTTGGAGG 0: 1
1: 0
2: 14
3: 221
4: 3723
967220494_967220506 18 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220506 3:187244197-187244219 CCAGGAGGCAGGGTTGGAGGTGG 0: 1
1: 0
2: 10
3: 140
4: 1221
967220494_967220498 0 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220498 3:187244179-187244201 CTTGCTTGGCCATAGAAGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
967220494_967220501 8 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220501 3:187244187-187244209 GCCATAGAAGCCAGGAGGCAGGG 0: 1
1: 0
2: 2
3: 44
4: 517
967220494_967220499 3 Left 967220494 3:187244156-187244178 CCCTGCTGCCTCTCTACAGGCAG 0: 1
1: 0
2: 5
3: 43
4: 301
Right 967220499 3:187244182-187244204 GCTTGGCCATAGAAGCCAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967220494 Original CRISPR CTGCCTGTAGAGAGGCAGCA GGG (reversed) Intronic
900895348 1:5479362-5479384 CTGCCTGTGGGGATGCAGGAAGG + Intergenic
901181070 1:7342244-7342266 CGACCTGTCCAGAGGCAGCAAGG + Intronic
902392967 1:16116769-16116791 CAGCCTGTGGAGAGTCAGAAAGG - Intergenic
902602525 1:17550026-17550048 CTGGCTGTAGAGAGCCAGGGTGG + Intronic
902968998 1:20033143-20033165 CTGCCTGTTGAGAGGTAGTATGG + Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
904248352 1:29204297-29204319 CTGGTTTTTGAGAGGCAGCAGGG + Intronic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905206065 1:36343445-36343467 CTGCCTGCAGGGAGGCAGACAGG + Exonic
905715859 1:40149308-40149330 CTGAGTTTAGAGAGGGAGCAGGG + Intergenic
906291183 1:44620130-44620152 GTGTCTTTAGGGAGGCAGCATGG + Intronic
906721888 1:48012415-48012437 CTGCTTGTGGAGAGGCCTCAGGG - Intergenic
906733320 1:48101704-48101726 CTCACTGTAGACAGGGAGCAAGG + Intergenic
906950426 1:50330860-50330882 CTGCCTGTAGAGGGGGAAAAGGG + Intergenic
907286928 1:53386683-53386705 CAGCCTGGGGAGAGGCTGCAGGG + Intergenic
907536023 1:55158100-55158122 ATGCAGGTAGAGAGGCAGCAAGG + Intronic
907732379 1:57079650-57079672 GGGCCTGTAGTGAGTCAGCATGG - Intronic
907904616 1:58773093-58773115 ATGGCTGGAGAGTGGCAGCATGG + Intergenic
913153202 1:116066210-116066232 CTGCCTGCTCAGAGGCAGCCTGG + Intronic
914195509 1:145446213-145446235 CTCCCTGGATAGAAGCAGCATGG - Intergenic
914720072 1:150282353-150282375 CAGCCAGTAGAGAGGCAGCCAGG - Intergenic
915497826 1:156293989-156294011 CTTCCTGGAGAGAGGCAGATGGG - Intronic
916890287 1:169106721-169106743 CTGCCTGCAGAGAGCCAGGCCGG + Exonic
917070166 1:171141864-171141886 CTGCCTGTTGAAAGGAGGCAGGG - Intronic
917117470 1:171616941-171616963 ATGCCTGTACAGTGTCAGCAGGG - Intergenic
918326342 1:183414215-183414237 CAGGCTGTAGAGCAGCAGCAGGG - Intronic
919775438 1:201191317-201191339 CTACCAGTTGAGAGGTAGCAGGG + Intronic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920527988 1:206683007-206683029 CTGCCTTTTCAGAGGCAGCAAGG - Intronic
920563231 1:206954150-206954172 ATGCCTGTAGAGGTGCAGCATGG + Intergenic
921051229 1:211513271-211513293 CTGCATGGTGAGAAGCAGCATGG - Intergenic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
923269827 1:232345673-232345695 CTTCCTGTTGCGAGGCAGCATGG + Intergenic
923504215 1:234591536-234591558 CTGCCAGAAGTGAGGTAGCAAGG - Intergenic
923622392 1:235589209-235589231 ATGCCTGTACAGTGTCAGCAGGG - Intronic
923959522 1:239061545-239061567 CTACCTGTAAAAAGGCATCATGG - Intergenic
1063839438 10:10053192-10053214 ATGCCTGTTGTGAGTCAGCATGG + Intergenic
1063866385 10:10369296-10369318 CTGCGTGTTGAAAGGCAGGATGG - Intergenic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1067349832 10:45465596-45465618 CAGCCTGGAGAGAGCCAGGATGG + Intronic
1067955891 10:50790094-50790116 CTGCCTTTGGAAAGGCAGGAAGG + Intronic
1070384993 10:75916383-75916405 CTGGCAAGAGAGAGGCAGCAGGG + Intronic
1070548428 10:77470944-77470966 CTGCCCTCAGAGAGGCAGCCCGG + Intronic
1070752499 10:78972552-78972574 CAGCCCATAGAGAGGGAGCAGGG + Intergenic
1070769297 10:79072992-79073014 CTGCCTTTAGAGAGGATGAAGGG + Intronic
1071114873 10:82206368-82206390 ATTCCTGCAGAGGGGCAGCAGGG - Intronic
1072816227 10:98512223-98512245 TTACCTCTAGAGGGGCAGCAAGG - Intronic
1075442785 10:122493182-122493204 CTGCTTGGAGGGAGACAGCAGGG - Intronic
1075642562 10:124075344-124075366 CTGGCTGGGGAGAGACAGCAGGG - Intronic
1076379787 10:130017166-130017188 CTGCCTGGAGAGAGGCAGGCCGG - Intergenic
1076598910 10:131644528-131644550 CTGCCGGTGGAGAGGCAGCACGG + Intergenic
1076995248 11:294533-294555 CTGCAGGGAGAGAGGCAGCCTGG - Intronic
1077141737 11:1027818-1027840 CTGCGGGCAGAGAGCCAGCATGG + Intronic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1078013849 11:7595225-7595247 CTGCCTTTAGAAAGGTAGCAAGG + Intronic
1078760820 11:14249982-14250004 CTACATTTGGAGAGGCAGCATGG - Intronic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080402902 11:31953998-31954020 CAGCCAGGACAGAGGCAGCAAGG + Intronic
1080640655 11:34156404-34156426 CCACCTGTAGAAGGGCAGCAGGG + Intronic
1081724916 11:45321401-45321423 CTGGCGGAAGAGAGGCATCAAGG - Intergenic
1083314281 11:61804727-61804749 CTGGAAGTAGAGAGGCAGCAAGG + Exonic
1083687388 11:64384699-64384721 CTGCAGGTTGAGAGGCAGCCAGG + Intergenic
1083848518 11:65351664-65351686 CTTCCTGCAGAGAGGCAAAATGG - Exonic
1083935121 11:65865963-65865985 CTGCAGGAAGAGAGGCAGCGAGG - Intronic
1084187853 11:67484430-67484452 CTGACTTCAGAGATGCAGCATGG + Intronic
1084553209 11:69861304-69861326 CTGCCCAAAGGGAGGCAGCAAGG + Intergenic
1084800182 11:71538506-71538528 CAGCCTGAAGAGCAGCAGCAGGG - Exonic
1085265220 11:75233881-75233903 CTGCCAGTTGTGAGGCAACAGGG + Intergenic
1086927726 11:92658611-92658633 CAGCCTCTAGGGAGGCAGCAAGG - Intronic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1088695837 11:112365256-112365278 ATGCCTGTACAGTGTCAGCAGGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089114895 11:116086779-116086801 CTACCTGTAGAATGCCAGCAAGG - Intergenic
1089220878 11:116870398-116870420 CTGCCTGAAGAGAGACAGGAAGG + Exonic
1089697308 11:120224051-120224073 TTTCCTGTTGAGAGGAAGCAGGG + Intronic
1091526707 12:1309531-1309553 CCACCTGTGGAGAGACAGCATGG + Intronic
1091906041 12:4189816-4189838 CCGACTGTAGAAAGGCAGCAGGG + Intergenic
1092138453 12:6166422-6166444 GTTCCTGTGGAGAGGGAGCATGG - Intergenic
1092593217 12:9970694-9970716 CAGTCTGTAGAGAGATAGCAAGG + Intronic
1092918165 12:13206860-13206882 CTGCCTGAACAAAGGCAACAAGG + Intronic
1094396931 12:30016999-30017021 CTGCGAGAAGAGAGGCAGAAAGG - Intergenic
1098867578 12:75780430-75780452 CTGTCTGGAGGGAGGCAGCAGGG + Intergenic
1101312861 12:103599415-103599437 CTCCCTTCTGAGAGGCAGCATGG + Intronic
1101559934 12:105847230-105847252 CTGCCTGGAGACAGTCAGGATGG + Intergenic
1102082201 12:110107580-110107602 CTCCCTCTAGAGAGTCTGCACGG + Intergenic
1102485648 12:113253785-113253807 CTGTGTGTGGAGAAGCAGCAAGG + Intronic
1103684596 12:122722051-122722073 CGCCATGTAGAGAGGCATCAAGG - Intergenic
1103968238 12:124653448-124653470 CTGCCTGCAGCGACCCAGCAGGG - Intergenic
1104648511 12:130514167-130514189 GTGCTTTGAGAGAGGCAGCAGGG - Intronic
1104708527 12:130967810-130967832 CTGCCTGTAGGGCAGCAACATGG + Intronic
1105016599 12:132789483-132789505 CTGCCTGTTGAGAGACTGCGTGG + Intronic
1106027991 13:25973384-25973406 CTGCCTGTTTAGAGGCAGCCTGG - Intronic
1106448997 13:29862872-29862894 CTGGATGTAGGGAGGCACCATGG - Intergenic
1108601029 13:51995452-51995474 CTGCTTGTGGACAGACAGCAGGG + Intronic
1109397274 13:61776926-61776948 CTGCTTACAGATAGGCAGCAAGG + Intergenic
1111843074 13:93473689-93473711 CTGCCAGTAGGGGAGCAGCATGG - Intronic
1113268846 13:108650367-108650389 CTGCCTGAATGGAGCCAGCAAGG + Intronic
1113502441 13:110787142-110787164 CTGCCTCTGGAGAGGCCTCAGGG - Intergenic
1113569421 13:111343278-111343300 CTTCCTGTGGGGAGGCTGCAGGG + Intronic
1113576627 13:111399659-111399681 GTGCCTGCACAGAGGAAGCAGGG - Intergenic
1113635032 13:111913532-111913554 GTGGCGGAAGAGAGGCAGCATGG - Intergenic
1115572673 14:34681497-34681519 AGGCCAGAAGAGAGGCAGCAGGG - Intergenic
1117153028 14:52908662-52908684 CTGCCAGCAGAGGGGCATCAGGG + Intronic
1117189899 14:53279183-53279205 GTGCCTGTACAGTGTCAGCAGGG + Intergenic
1117759634 14:59013899-59013921 ATGCCTGTACAGTGTCAGCAGGG - Intergenic
1119566113 14:75630757-75630779 CAGGCTTTAGAGAGGCAGAAAGG - Intronic
1120142371 14:80942830-80942852 CTGCCTGTTGGGAGGGAGGAGGG - Intronic
1121095517 14:91215651-91215673 CTGGCTTTTGAGGGGCAGCAGGG - Intronic
1122147452 14:99700130-99700152 CTGCCTGGCCAGAGGCAGTAGGG + Intronic
1122552733 14:102558776-102558798 CTGCCTGTTGAGTGGCTCCAGGG + Intergenic
1122558103 14:102592327-102592349 CTGCCTGGAGAGATGGATCATGG + Intergenic
1128234514 15:66058672-66058694 CTCTCTGTAGGGAGGCATCAGGG + Intronic
1128757183 15:70191078-70191100 CTCCCTGCAGATGGGCAGCAGGG - Intergenic
1128938304 15:71766994-71767016 CTGACCGTAGAGGGGCAGCATGG + Intronic
1129224670 15:74162039-74162061 CTGCCTGTGGAGCGGAAGAATGG + Intergenic
1129231426 15:74199172-74199194 CTGTATGAAGAGAGGCATCAAGG + Intronic
1130554900 15:84915749-84915771 CGGCCAGAAGAGAGGCAGGATGG - Intronic
1131057909 15:89386936-89386958 CTGTATGAAGAGAGGCAGCTGGG - Intergenic
1132615683 16:840225-840247 CTCCCTGTGGAGGGGCAGCCTGG + Intergenic
1134090310 16:11388079-11388101 GGGCCAGTAGAGAGGGAGCAGGG + Intronic
1134201422 16:12202804-12202826 CTGCCTGCAGAGAGGCCCCTTGG + Intronic
1134450136 16:14358292-14358314 CTGTCCATAGAAAGGCAGCAAGG + Intergenic
1135864531 16:26089026-26089048 CTGCCTGTAGAGTTGCTCCAGGG + Intronic
1136032598 16:27514450-27514472 CTGCTTGTAGAAAGGGAGCCTGG - Intronic
1136044862 16:27607518-27607540 CAGCCTATAGGGAGGCAGCGGGG + Intronic
1136232545 16:28895081-28895103 CAGCCTGTGGAGAAGCTGCAGGG - Intronic
1138046071 16:53726725-53726747 CTGCCTATTGTGAAGCAGCAAGG - Intronic
1138219679 16:55240106-55240128 TGGCCTATAGAGAGGCAGTACGG + Intergenic
1138551859 16:57752805-57752827 CTGCCTGTACAGCGGCTGCCAGG + Exonic
1138554341 16:57763114-57763136 CTGGCTGTGGGGAGACAGCAGGG - Intronic
1140557552 16:75939018-75939040 ATGCCTGTACAGTGCCAGCAGGG - Intergenic
1140939513 16:79708213-79708235 CCGCCTGTTGAGAGCCATCAAGG - Intergenic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141820550 16:86442537-86442559 GTGCCAGGAGGGAGGCAGCATGG - Intergenic
1142129479 16:88426146-88426168 CCGCCTCCACAGAGGCAGCAGGG + Intergenic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1145052652 17:19675539-19675561 CTGCCTGGAGAGAGGAAAAAAGG - Exonic
1145189654 17:20827853-20827875 AGTCCTGTAGAGAGGCTGCATGG + Intergenic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1146490516 17:33278144-33278166 CTGCCTGAAGCCAGGGAGCAGGG - Intronic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148666037 17:49375687-49375709 ATGCCAGCAGAGAGGAAGCAGGG + Intronic
1149009890 17:51845365-51845387 CAGCCTGCAGAGAGGCCCCATGG + Intronic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085530 17:52710649-52710671 CTGCCTATAGAGAGGCAGGTGGG + Intergenic
1149085537 17:52710690-52710712 CTGCCTACAGAGAGGCAGCTGGG + Intergenic
1149220931 17:54414655-54414677 CGGACTGTAGAGAGGTAGGAAGG - Intergenic
1150077247 17:62203082-62203104 AGTCCTGTAGAGAGGCTGCATGG - Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150937136 17:69648847-69648869 CTCCCTCCAGAGTGGCAGCATGG - Intergenic
1151352700 17:73541169-73541191 CTGGCTGGGGAGAGGCAGCTGGG + Intronic
1153849438 18:9079445-9079467 CTGCCTGTAGAAAGAAAGAAAGG - Intergenic
1155101023 18:22609857-22609879 CTGACGGATGAGAGGCAGCAGGG + Intergenic
1157121686 18:44917338-44917360 CTGCCTGGGGAGAGGCAGTTTGG + Intronic
1157295195 18:46437360-46437382 CTGCCAGGAGATAGGCAGCCTGG + Intronic
1157403505 18:47405134-47405156 CTCCCTGGAGAGAGGCAGGTGGG + Intergenic
1157481778 18:48059885-48059907 CTGCCTGTAGGGAAGCTGCCTGG - Intronic
1160257949 18:77263566-77263588 CTCCCTATCGAGAGGCACCAGGG - Intronic
1160532053 18:79571430-79571452 CTCCCCGTAGAGAGGGAGGATGG - Intergenic
1161235004 19:3193360-3193382 CTGCTTGTAGATAGACAGCAGGG - Exonic
1161570927 19:5030569-5030591 CGGCCTGCAGAGAGGCAGCCAGG + Intronic
1162041660 19:7974621-7974643 CTGCCTGTGAAGGGGCAGCCTGG + Intronic
1162859710 19:13497069-13497091 ATGGTTGTAGAGAAGCAGCATGG - Intronic
1163185481 19:15636154-15636176 CTGCTTGAGGAGAGGCAGCTTGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1163632032 19:18422382-18422404 CTGCCAGTGGGGAGGCTGCAGGG + Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163750635 19:19075385-19075407 CTGCATGAACAGAAGCAGCATGG + Intronic
1164705300 19:30314922-30314944 CTGCAGGTAGAGAGCCAGCAGGG - Intronic
1165174893 19:33921644-33921666 CTACCTCTAGAGACGCAGCAAGG + Intergenic
1165339931 19:35204179-35204201 CTGCATGTAGGGAGGCTGGACGG - Intergenic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1168692626 19:58386170-58386192 CTACCTGTTCAGAGGCAGCTGGG + Intergenic
925004855 2:434192-434214 GTGCCTTTAGAAAGGAAGCAAGG - Intergenic
925975836 2:9141397-9141419 CAGCCTGTAGAGCGTCGGCAGGG + Intergenic
926314671 2:11700568-11700590 CTGCCTCCAGAGAGGCAGGGAGG - Intronic
927689526 2:25197971-25197993 CAGGCTGTGGAGAGGCAGCATGG + Intergenic
927708872 2:25313165-25313187 CAGCCTGTGGAGACCCAGCAGGG + Intronic
928128021 2:28629480-28629502 CTCCCTGTTGAGAAGCAGCATGG + Intronic
928314502 2:30235191-30235213 GGGGCAGTAGAGAGGCAGCAGGG - Intronic
931314231 2:61112142-61112164 CTGCTTGTAGAGATGCAAAACGG - Intronic
931848006 2:66224659-66224681 CTACATGTGGCGAGGCAGCATGG + Intergenic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
936397437 2:112140311-112140333 TGGCCTGGAGAGAGGCAGGAGGG - Intronic
937441210 2:121917705-121917727 CTGACTGTGGAGTGGGAGCATGG + Intergenic
937651011 2:124319060-124319082 CTACCTGTTGAGAGGAAGGATGG + Intronic
938406552 2:131036068-131036090 CTGCAGGCAGAGAGGCAGCCTGG + Intronic
938699359 2:133862498-133862520 GTGCCTGTATAGTGTCAGCAGGG + Intergenic
939350905 2:141036539-141036561 CTGCCTCTAGAAAAGGAGCAGGG + Intronic
943786857 2:191886778-191886800 CTGCATGAAGAGAGGCAGAAAGG + Intergenic
944326072 2:198405164-198405186 TTGCATTTAGAGAGGCAGTATGG + Intronic
946089613 2:217209116-217209138 GTGCCTGTTGATAGGGAGCAGGG - Intergenic
946991073 2:225330292-225330314 CTGACTCCAGAGAGGGAGCATGG + Intergenic
948537093 2:238654418-238654440 CTGCCTGCAGGGAGGCTGCCTGG + Intergenic
948612740 2:239180139-239180161 CTGGCTGTGCAGGGGCAGCAAGG - Intronic
948692592 2:239715956-239715978 CTCCCTGTGGAGAGACGGCACGG - Intergenic
948748133 2:240110481-240110503 CTGCCTGGAGTGGGGGAGCAGGG - Intergenic
949005929 2:241647769-241647791 GTGGCTTTAGAGAGGTAGCAGGG + Intronic
949069589 2:242016070-242016092 CTGCCCGCATTGAGGCAGCAGGG - Intergenic
1168911550 20:1451950-1451972 CAGCCTGCAAAGGGGCAGCAAGG + Intronic
1169046197 20:2536355-2536377 TTCCCTGCAAAGAGGCAGCATGG - Intergenic
1169500843 20:6158923-6158945 CTGCCTGTGGGGAGCCAGGATGG - Intergenic
1170573374 20:17645223-17645245 CTTCCTGCACAGGGGCAGCATGG + Intronic
1171023840 20:21610670-21610692 CTGCTTGTAAAGAGGCACCTTGG - Intergenic
1171495539 20:25552552-25552574 CTGTCTGTATAGTGCCAGCATGG - Intronic
1173486647 20:43446151-43446173 TTGACTGTCGAGAGGCAGGAAGG - Intergenic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1173873588 20:46356535-46356557 CAGCCTGAAGGGAGGCAGCAGGG + Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1175499656 20:59440850-59440872 CTGCCGGCAGCCAGGCAGCAAGG - Intergenic
1175546081 20:59778588-59778610 GTGCTGGTAGAGAGGCTGCATGG - Intronic
1176021587 20:62965035-62965057 ATGGCTGCAGAGGGGCAGCAGGG - Intronic
1176031951 20:63017072-63017094 CTGGCTGCCGGGAGGCAGCAAGG + Intergenic
1177393773 21:20507984-20508006 CTGCCTGGTGAGGAGCAGCAAGG + Intergenic
1178415371 21:32400607-32400629 CTGCTTCTAGGGAGGCTGCAGGG - Intergenic
1178600888 21:33993406-33993428 CTTCCAGAAGAGAGGCAGTAGGG + Intergenic
1178644372 21:34373325-34373347 CTGCCTTAAGAGAGGGATCAGGG - Intergenic
1179054880 21:37922137-37922159 TTACCTGCAGACAGGCAGCAAGG + Intergenic
1179058488 21:37957554-37957576 CTGCCTGTAAAGACTCAGCATGG + Intronic
1182098081 22:27639268-27639290 CGGGGTGCAGAGAGGCAGCAGGG - Intergenic
1182150037 22:28021379-28021401 CTGCCTGGGGAGGGGCAGCTAGG + Intronic
1183213467 22:36465033-36465055 TTGCCTGCAGAGAGGCGGCAGGG - Intergenic
1183373312 22:37448013-37448035 GTGCATGTAGAGAGGCAGTTTGG - Intergenic
1184175077 22:42784473-42784495 ATGGCTGCAGAGAAGCAGCATGG - Intergenic
1184595029 22:45508682-45508704 CTGCCTCTGCAGAGGCTGCATGG + Intronic
949508749 3:4750489-4750511 CTGCCTGCAGATAGTGAGCAAGG - Intronic
950689908 3:14647392-14647414 CTGGATTTAGAGAGGCAGCAGGG - Intergenic
952067064 3:29583336-29583358 CTGCCTGCTGGGTGGCAGCATGG + Intronic
952951832 3:38532041-38532063 CTGCCTCTAAAGAGTTAGCAGGG - Intronic
953782042 3:45880016-45880038 CTGCCTGTACGGAGGCATCATGG - Intronic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
954328265 3:49875427-49875449 CTGCCAGATGAGAGGCTGCAGGG + Intergenic
955660867 3:61297673-61297695 GTGCATGTGGAGAGGAAGCAAGG + Intergenic
956151893 3:66252409-66252431 ATGTCTGTAGGGAGGTAGCAAGG + Intronic
957434831 3:80161330-80161352 CAGCATGTAGAGAGGAACCAAGG - Intergenic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
961152233 3:124648656-124648678 CAGCCTGTTGAGTGGTAGCATGG - Intronic
963850056 3:150202009-150202031 CTGCCTGTAGCCAGGCAGCAGGG + Intergenic
964031066 3:152139463-152139485 AAGACTGTGGAGAGGCAGCATGG + Intergenic
967220494 3:187244156-187244178 CTGCCTGTAGAGAGGCAGCAGGG - Intronic
968107106 3:196009140-196009162 CTGCCCGCATCGAGGCAGCAGGG + Intergenic
968490325 4:886704-886726 CTGCGTGTGGAGCGTCAGCAGGG - Intronic
969388349 4:6871988-6872010 TTGCCTGCACAGAGGCAGGAGGG + Intronic
969537415 4:7765222-7765244 TGGCCTGTTGGGAGGCAGCAGGG - Intronic
970848725 4:20575605-20575627 GTGCCTGGAAGGAGGCAGCAAGG - Intronic
971103844 4:23499460-23499482 CTGCCTCTGGAGAGGCCTCAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973899920 4:55458384-55458406 CTGACTGGAAAGAGGCAGCCAGG - Intronic
973926397 4:55742946-55742968 GTGCCTGTACAGTGTCAGCAGGG - Intergenic
975120143 4:70719295-70719317 CTACCTGGAGAGAGGCAGGGTGG + Intronic
977308232 4:95351995-95352017 CTGACTGTATCCAGGCAGCAAGG - Intronic
982364714 4:154564325-154564347 GTGCCACTAGAGAGGTAGCATGG - Intronic
983918436 4:173316899-173316921 CCGCCTGTAGAGAGACAGAGGGG - Intronic
985401050 4:189594411-189594433 ATGCTTGTGGATAGGCAGCAAGG - Intergenic
986167239 5:5285279-5285301 CTGCAGGTGGAAAGGCAGCATGG - Intronic
986210164 5:5664568-5664590 CTGCCGGGACAGAGGCAGCCTGG - Intergenic
990722890 5:58717800-58717822 ATACCTGGAGAGAGACAGCAGGG - Intronic
990967207 5:61462020-61462042 CTTACTGTAGAGAGCCAGCTGGG - Intronic
992225569 5:74616880-74616902 GTGCCTGTACAGTGTCAGCAGGG + Intergenic
993050739 5:82923198-82923220 CTGGCTGTAAGGAGGCAGCAGGG - Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
996217922 5:120891771-120891793 CTCCATGTAGGGAGGCAGAAGGG + Intergenic
997245521 5:132345207-132345229 CTGCCTGCAAGAAGGCAGCAAGG + Intergenic
997715206 5:136037441-136037463 AAGCCTGTCGAGAGGCAGCCAGG - Intronic
999200574 5:149813396-149813418 CGACCTGAAGAGAGCCAGCATGG + Intronic
1000212032 5:159116248-159116270 CTTTCTCTTGAGAGGCAGCATGG - Intergenic
1001037698 5:168309494-168309516 CTGCCTGTGGAGAGGGGGCTGGG - Intronic
1001157098 5:169282075-169282097 CTTTCTGTAGAGAGGATGCAAGG - Intronic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1004526480 6:16413312-16413334 TTTCCTTTTGAGAGGCAGCATGG - Intronic
1005600370 6:27420689-27420711 TTGCCGGTAGAGATGCAACATGG + Intergenic
1006574226 6:35032224-35032246 CTGACTGCAGAGAGGCCTCATGG - Intronic
1006992639 6:38228495-38228517 GTGCATGTAGAGGGGCAGAAGGG + Intronic
1008892169 6:56507586-56507608 TTGCCAGTAGAGTGGCAGGAAGG + Intronic
1009164980 6:60329997-60330019 CTGCTTCTGGAGAGGCATCAGGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1018915640 6:168130865-168130887 CTGCCTGTGCTGGGGCAGCAGGG + Intergenic
1021202430 7:17741631-17741653 CTGCCTGGCGAGGAGCAGCAGGG - Intergenic
1021595700 7:22314233-22314255 CTGGCTGAAGAGAAGCAGGAAGG + Intronic
1022519259 7:30995300-30995322 CTGCCTGAAGACAGCCAGCGTGG + Intergenic
1023305138 7:38818150-38818172 TCACCTGTATAGAGGCAGCAAGG + Intronic
1026194757 7:68163262-68163284 CTCCCTGCAGAGAGGTACCATGG - Intergenic
1027250898 7:76398033-76398055 CTGCCAGGAGACAGGGAGCAGGG - Intronic
1027755435 7:82205022-82205044 CTGCATGTACAGTGTCAGCAGGG - Intronic
1028428360 7:90716975-90716997 CTGCTTGCAGACTGGCAGCACGG - Intronic
1028956735 7:96701934-96701956 ATTCCTGGAGAGGGGCAGCATGG + Intronic
1030161324 7:106511257-106511279 CAGCATGAAGAGAGGAAGCATGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032338121 7:131044969-131044991 CTGGGTGTAGGGTGGCAGCATGG - Intergenic
1033157911 7:138972182-138972204 TTGCCTGGAGAGAGGAAGAAAGG - Intronic
1033379256 7:140797770-140797792 CTGCCATTAGAAAGGCATCATGG + Intronic
1034009591 7:147514751-147514773 GTGAGTGTAGAGAGGCAGCCAGG - Intronic
1034268136 7:149791000-149791022 CTCCCTGCAGAGGGGCAGAAAGG - Intergenic
1034822964 7:154234139-154234161 CTTCCTGTTGAGAGGCTACATGG - Intronic
1035167838 7:157002365-157002387 CTGCCAGGTGAGAGGCAGCCAGG - Intronic
1035679875 8:1480119-1480141 CTGCCTGTAGCCAGACAGCCGGG - Intergenic
1035760055 8:2062310-2062332 CTGACTGCAGACAGGCTGCAGGG + Intronic
1036207576 8:6816194-6816216 CTGCCTTTAGAGAGTCATTATGG + Intronic
1037244931 8:16822705-16822727 CTGCTTCTAGAGAGGCCTCAGGG + Intergenic
1037819611 8:22129349-22129371 CTGCATGTGGAGAGGCAGCATGG - Intronic
1038439524 8:27561662-27561684 CTGCCTTTGGAGAGGCAGATGGG - Intergenic
1038677581 8:29637440-29637462 TTGCCTGCAACGAGGCAGCAAGG + Intergenic
1040436632 8:47397825-47397847 CAGCCTCTAGAGAGGGTGCAGGG + Intronic
1043826279 8:84932673-84932695 CTACAGGTAGAGAGGAAGCAAGG - Intergenic
1044517223 8:93153650-93153672 TTCCCTGTAGACAGGCAGGACGG - Intronic
1044775726 8:95685579-95685601 CTGCCTGTACAGCATCAGCAGGG + Intergenic
1045620654 8:103973960-103973982 CTGCCAGTGGAGAGTCAGCAAGG - Intronic
1046947447 8:119987724-119987746 CTGCCTCTAGAGAGGCAGCCTGG + Intronic
1048580737 8:135728305-135728327 GTGCCTGGAGAGAGGCATCAGGG - Intergenic
1049473519 8:142786707-142786729 CTGCCTGGCGGGGGGCAGCAGGG - Intergenic
1049856196 8:144863459-144863481 CTGCCTGTTGCGAGGTAGTATGG + Intergenic
1050674378 9:8035859-8035881 CTGCTTCTAGAGAGGCCTCAGGG + Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1051129314 9:13841756-13841778 CTGCTTGCAGAGAGGAATCAGGG - Intergenic
1051157037 9:14159564-14159586 CTGCCTGCAGAGATGCATGAAGG - Intronic
1052384624 9:27808607-27808629 CTGCCTGTTGAGAGGTAGTATGG + Intergenic
1052974851 9:34402757-34402779 CTCCCTGAAGAATGGCAGCATGG - Exonic
1053353302 9:37427463-37427485 TGGCCTTTAGAAAGGCAGCATGG - Intronic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1055074241 9:72197292-72197314 AAGCCCATAGAGAGGCAGCAGGG - Intronic
1056160451 9:83886087-83886109 CTGCCTGTGGGGAAGCAGCATGG - Intronic
1056359765 9:85843780-85843802 CTGCCTGTGGGGAAGCAGCATGG + Intergenic
1057132620 9:92664635-92664657 CTGCCTGTAAAGGGGAAGCAGGG + Intronic
1057383694 9:94590079-94590101 GTGCCTGGAGAGAGGGTGCAGGG - Intronic
1057744885 9:97742932-97742954 CTGCTTACAGAGATGCAGCAAGG - Intergenic
1057944245 9:99310762-99310784 ATGCCTGAAGGGAGTCAGCATGG - Intergenic
1058360081 9:104134864-104134886 CTGCCTCTAGAGAGAAAGCCAGG - Intronic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060532287 9:124354972-124354994 CTGCGGGCAGACAGGCAGCAGGG + Intronic
1060600087 9:124871450-124871472 CTGCAGATAGAGCGGCAGCATGG + Intronic
1060931368 9:127491501-127491523 CAGCCTGTTGCGAGGCAGGAGGG + Intronic
1061577054 9:131513894-131513916 GGGCCTGTGCAGAGGCAGCAAGG - Intronic
1061798411 9:133101592-133101614 CTGGTTGTAGAGCGGCAGCGCGG + Exonic
1186424600 X:9454122-9454144 CTGGCTGTAGAGAATAAGCATGG - Intergenic
1189598804 X:42599308-42599330 GATCCTGTAGAGAGGCAGCCAGG + Intergenic
1192873609 X:75207313-75207335 CTGCCTGTTGAGAGGTATTATGG + Intergenic
1195761074 X:108247126-108247148 CTCACTATTGAGAGGCAGCATGG + Intronic
1199093650 X:143717134-143717156 TTGCCTGTTGAGAGGTAGCATGG - Intronic
1199207928 X:145170966-145170988 CAGCTTATAGAGAGGGAGCAAGG + Intergenic
1199214683 X:145251026-145251048 TTGCCTGTTGAGAGGCAGCATGG + Intronic
1200244852 X:154517439-154517461 CTGTCTGGAGAGCAGCAGCAGGG + Intergenic
1200914528 Y:8559806-8559828 CTGGATGAAGGGAGGCAGCAAGG + Intergenic