ID: 967222165

View in Genome Browser
Species Human (GRCh38)
Location 3:187256568-187256590
Sequence AACCTTCACCTTCTTCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222165_967222170 27 Left 967222165 3:187256568-187256590 CCTGGGAGAAGAAGGTGAAGGTT 0: 1
1: 0
2: 5
3: 29
4: 326
Right 967222170 3:187256618-187256640 CAAGATTTTCCAGCATCTCCAGG 0: 1
1: 0
2: 2
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222165 Original CRISPR AACCTTCACCTTCTTCTCCC AGG (reversed) Intronic
901673943 1:10872040-10872062 AAACTTCTGCTTCTTCTCCAAGG - Intergenic
903061713 1:20673146-20673168 GATCTTCACCTTCACCTCCCGGG - Intronic
903067861 1:20710834-20710856 GACCTTCACCTTCTCCTTTCTGG - Intronic
903374504 1:22857413-22857435 GCCCTTCTCCTTCATCTCCCTGG - Intronic
903934412 1:26885247-26885269 AACATGCACCTGCGTCTCCCAGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
905389332 1:37626204-37626226 ACCCTGCAGCATCTTCTCCCCGG + Intronic
905442429 1:38004087-38004109 AACCCTCACCCTCTGCTACCGGG + Intronic
906036348 1:42752442-42752464 AGCCTTCGCCTTCCTCTTCCTGG - Intronic
906262223 1:44402656-44402678 AACCTCCACCTTGTCCACCCAGG + Intergenic
907303007 1:53500001-53500023 CACAGTCACCTTCTTCTCTCAGG + Intergenic
909914146 1:81296780-81296802 AATCCTCAACTTCTTATCCCTGG - Intergenic
910071239 1:83216223-83216245 AAACTTCACCTGAATCTCCCAGG - Intergenic
911289054 1:96033462-96033484 AACCTAAACTTTCTTCTGCCTGG + Intergenic
911448661 1:98035031-98035053 AACCTTGACCTTTTTTTCACTGG + Intergenic
911649998 1:100377114-100377136 AACCTCCACCTCCACCTCCCGGG + Intronic
911675710 1:100656193-100656215 TACCTTCATCCTCTTCTCCATGG - Intergenic
912207844 1:107527861-107527883 AGCCTTCACCTTCTTTCACCTGG + Intergenic
912410501 1:109477835-109477857 CTCCTTCACCTTCTTCTGGCTGG + Exonic
913662124 1:121013274-121013296 AAGCTTCTCCTTCTGCACCCTGG - Intergenic
914013498 1:143796459-143796481 AAGCTTCTCCTTCTGCACCCTGG - Intergenic
914164326 1:145164726-145164748 AAGCTTCTCCTTCTGCACCCTGG + Intergenic
914457331 1:147848101-147848123 ACCCTTCACCTTCCTCTACCAGG - Intergenic
914652123 1:149705068-149705090 AAGCTTCTCCTTCTGCACCCTGG - Exonic
915080021 1:153345658-153345680 AAGCATCACCTGCTTATCCCTGG + Intronic
915223957 1:154397880-154397902 CACCTTCTTCCTCTTCTCCCTGG + Intergenic
915562508 1:156695506-156695528 AACCTCCACCTCCACCTCCCAGG + Intergenic
916287775 1:163129759-163129781 AACTTTCTCCATCTTCTCCCAGG - Intronic
917936975 1:179877905-179877927 ATCCTTCACCCTCTACTGCCAGG + Intergenic
918670901 1:187215602-187215624 AACCAACACCTTCATCTCTCTGG + Intergenic
918834137 1:189438316-189438338 TACCATCACCTTATTCTTCCAGG - Intergenic
920066420 1:203272892-203272914 CCCCTTCACCCTGTTCTCCCGGG - Intronic
920649264 1:207824554-207824576 AACCAGGACCTTTTTCTCCCTGG + Intergenic
920952472 1:210585492-210585514 AACCTCCACCTCCTCCTCCCGGG + Intronic
921116017 1:212092452-212092474 AACCTCAACCTCCATCTCCCAGG - Intronic
921166618 1:212512598-212512620 ATCCTTCCCCATCTGCTCCCAGG - Intergenic
923288751 1:232523348-232523370 AGCCCTCACCTCCTTCTCTCAGG + Intronic
923937196 1:238776426-238776448 AACCTTCATCCTCTTCTTCCTGG - Intergenic
924161906 1:241241543-241241565 GACCTTCACCTTCTGCCTCCTGG + Intronic
1063446923 10:6124695-6124717 AATCTTCACATTCTTCTGCATGG + Intergenic
1063603779 10:7505733-7505755 CTCCTTCCCCTTCTTCTCTCCGG + Intergenic
1064257829 10:13759366-13759388 AGCCTGCACTTCCTTCTCCCTGG + Intronic
1064466185 10:15584520-15584542 AAACTTCACCCACTTCTCACAGG + Intronic
1064575697 10:16744046-16744068 AACCTTGACCTTCTGGGCCCAGG - Intronic
1065221654 10:23502142-23502164 AACCTCCACCTCCACCTCCCAGG + Intergenic
1065722206 10:28637657-28637679 AATCTGCACCTTCTGCTCCAAGG + Intergenic
1065971846 10:30812011-30812033 ACCCCCCACCTTCTGCTCCCCGG + Intergenic
1066618778 10:37322778-37322800 AATTGTCACCTTCTTCACCCTGG + Intronic
1066695020 10:38069606-38069628 TACTTTCTCCTTCTACTCCCGGG - Intergenic
1066997491 10:42577573-42577595 TACTTTCTCCTTCTACTCCCGGG + Intronic
1067989408 10:51193741-51193763 AACATTAACCTTTTTCTCCTTGG - Intronic
1068579525 10:58723310-58723332 ATCCATCCCCTTATTCTCCCAGG - Intronic
1069318045 10:67132432-67132454 AACTTTCTCTTTCATCTCCCTGG - Intronic
1072807807 10:98435667-98435689 CACCTACACCTGCTTCTCCACGG - Exonic
1072997361 10:100257373-100257395 AACCTCCACCTCCGCCTCCCGGG + Intronic
1073997150 10:109328619-109328641 AACCTTCACCTTCACCTCCTGGG + Intergenic
1074081503 10:110171268-110171290 AACCTTACCTTTCCTCTCCCAGG + Intergenic
1074565113 10:114570682-114570704 AACCTCAACCTTCGCCTCCCAGG + Intronic
1075599887 10:123759776-123759798 ACCCTGCACCTTCTCCTCCACGG - Intronic
1077091238 11:779269-779291 AACCTGCCCCTCCTGCTCCCGGG - Intronic
1077257941 11:1597420-1597442 GACCATCTTCTTCTTCTCCCTGG - Exonic
1078921321 11:15833302-15833324 ACCCTTCACCTTGTTCTCCCAGG - Intergenic
1079427419 11:20356831-20356853 TTCCTTCACTGTCTTCTCCCTGG + Intergenic
1079566298 11:21887461-21887483 AACCTTGAACTGCTTCTACCAGG + Intergenic
1079949121 11:26780003-26780025 AGCCTTCACCTCCGCCTCCCAGG + Intergenic
1080051121 11:27860115-27860137 CCCCTTCAACTGCTTCTCCCGGG - Intergenic
1080476457 11:32596517-32596539 AACCTCCGCCTCCATCTCCCGGG - Intronic
1080759907 11:35238401-35238423 CACCTTCACCCTCTTCTTTCTGG - Intergenic
1080963370 11:37186213-37186235 AACCCTCACCTTCCTCATCCCGG + Intergenic
1081481299 11:43491998-43492020 ACCATTCTCCTTCTTCTCCCAGG + Exonic
1081916913 11:46738077-46738099 AACCTCCACCTCCACCTCCCAGG + Intronic
1082234432 11:49806148-49806170 AACCTACACTGTTTTCTCCCTGG + Intergenic
1083376376 11:62225921-62225943 AACCTCCACCTCCACCTCCCAGG - Intergenic
1083821883 11:65176680-65176702 AACCTCCGCCTCCATCTCCCGGG + Intergenic
1083835159 11:65261870-65261892 AACCTTCCCCTTGCTTTCCCCGG - Exonic
1084806383 11:71582088-71582110 GACCATCTTCTTCTTCTCCCTGG - Exonic
1086384161 11:86289901-86289923 AATCTTCCCCTTCTTTTCCCAGG - Intergenic
1087344454 11:96953254-96953276 AACCTTGACTTTCTTATCCAGGG + Intergenic
1088605024 11:111521142-111521164 AACCTACAGTTTCTTCTGCCTGG + Intronic
1088688445 11:112304593-112304615 AACTTTCCCCTTCTTCCCACAGG - Intergenic
1091841098 12:3621369-3621391 AACCTGCCCTTTCTTTTCCCAGG - Intronic
1092793431 12:12088728-12088750 AACCTTCACCTTGTTCTTTAGGG - Intronic
1093944309 12:25090103-25090125 AAGCTTCACTCTCTTCTCCAAGG - Exonic
1094182789 12:27609857-27609879 CACATTCACCCTCTTCTCCATGG - Intronic
1094338790 12:29387751-29387773 AACCTTCACCTTCACCTCCTGGG + Intergenic
1095957278 12:47813916-47813938 CACCTCCAACCTCTTCTCCCAGG - Intronic
1096430525 12:51539248-51539270 AACCTCCACCTTCTCCTGCCTGG + Intergenic
1096647324 12:53045970-53045992 ACCCTCCACCTTCTGCTCCAGGG + Intergenic
1100843903 12:98640356-98640378 AACCTCCACCTCCACCTCCCAGG - Intronic
1102659320 12:114512208-114512230 AACCTTCACCTTCACCTCCCGGG - Intergenic
1102995617 12:117347758-117347780 AACACTGACCTTGTTCTCCCTGG + Intronic
1103101678 12:118181485-118181507 AGCCTTCAGCTTGTTCTCCAGGG + Exonic
1103927438 12:124430725-124430747 GCGCTCCACCTTCTTCTCCCAGG + Exonic
1104330329 12:127838628-127838650 GACCTGCACCACCTTCTCCCAGG - Intergenic
1105245368 13:18645462-18645484 AACTTTCTCCATGTTCTCCCTGG + Intergenic
1105916950 13:24925739-24925761 TGCCTTCAGCTTATTCTCCCTGG - Intergenic
1106293829 13:28391713-28391735 CACCTTCATCTCCATCTCCCAGG + Intronic
1107323747 13:39217369-39217391 AACTATCAACCTCTTCTCCCTGG + Intergenic
1109630397 13:65037613-65037635 AACCTTCACCCCCATCTCCCAGG + Intergenic
1110417361 13:75267913-75267935 AACCTCCACCTCCACCTCCCAGG - Intergenic
1112606720 13:100913610-100913632 AACCTTCATCACCTTCTCACAGG - Intergenic
1112809455 13:103200705-103200727 GACCCTCACCTTCTAATCCCTGG - Intergenic
1115715183 14:36095545-36095567 TCCCCTCACCCTCTTCTCCCAGG + Intergenic
1115889142 14:38007684-38007706 AACCCTCAGCTTCTTCTACAGGG - Intronic
1117228863 14:53694369-53694391 AACCTCCACCTCCACCTCCCAGG - Intergenic
1118723523 14:68610341-68610363 AACCCTTTCCTTCTCCTCCCTGG + Intronic
1119549297 14:75496770-75496792 AACCCTAACCCTCTTCTCCAGGG + Intergenic
1120099237 14:80425050-80425072 AATCTCAACCTCCTTCTCCCGGG - Intergenic
1121134330 14:91481254-91481276 AACCTCCACCTTCGCTTCCCTGG - Intronic
1121523937 14:94605337-94605359 AATCTTCTCTTTCTTCTCTCTGG - Intronic
1121950721 14:98168534-98168556 CATCTTCAGCTTCTACTCCCTGG - Intergenic
1122032143 14:98920012-98920034 GACCATCACCTTCTTGTCACTGG + Intergenic
1122040134 14:98981635-98981657 AACCTTCATGTACTTGTCCCAGG + Intergenic
1123038863 14:105482333-105482355 AACCTTCACTCTCTTCTACTTGG + Intergenic
1123130882 14:105984376-105984398 AACCTTCATCTCCTTCCCACTGG + Intergenic
1123581113 15:21715597-21715619 AACCTTCATCTCCTTCCCACTGG + Intergenic
1123617762 15:22158220-22158242 AACCTTCATCTCCTTCCCACTGG + Intergenic
1124507900 15:30294653-30294675 AACCTGCTCTTTCTTCGCCCTGG - Intergenic
1124735655 15:32244004-32244026 AACCTGCTCTTTCTTCGCCCTGG + Intergenic
1125096159 15:35854628-35854650 CACTTTCACCTTCTTCTCAGGGG + Intergenic
1125516554 15:40324108-40324130 CATCTTCGCCTTCTTGTCCCCGG - Intergenic
1125855113 15:42941042-42941064 AACCTTGACCTCCTTCTCAAGGG + Intergenic
1126448621 15:48780136-48780158 CACCTTCAAGTTCTTATCCCAGG - Intronic
1128159535 15:65414450-65414472 AACCTTGATCTTCTTCCCCAAGG - Intronic
1128482125 15:68048294-68048316 CACCAGCCCCTTCTTCTCCCTGG + Intergenic
1128770033 15:70275170-70275192 AGCCCTCACATTCCTCTCCCTGG - Intergenic
1129274114 15:74434097-74434119 AACCTTCGCCACCCTCTCCCGGG + Exonic
1129456667 15:75679759-75679781 AACCTCCACCTCCACCTCCCGGG + Intronic
1129824259 15:78624442-78624464 AACCTTCTTCCTCTTCCCCCAGG - Exonic
1131290002 15:91099350-91099372 AGCCTTCCCCCTCTTCTCCATGG - Intergenic
1132732880 16:1371510-1371532 CACCCTCACCTGCTGCTCCCAGG + Intronic
1132744295 16:1430339-1430361 TCCCTTCACCTACTGCTCCCAGG - Intergenic
1133290073 16:4714476-4714498 AGCCTTCACCTTCTGCGCCTGGG + Intronic
1135186505 16:20320415-20320437 CACCTTCACCTTGATCTCCCTGG + Exonic
1137633198 16:49962553-49962575 ACCCTTCATCTCCTTCTTCCTGG - Intergenic
1139346030 16:66304478-66304500 AAGCTCCAACTTCATCTCCCTGG + Intergenic
1141534934 16:84672759-84672781 AACCTCCACCTCCACCTCCCAGG + Intergenic
1141762462 16:86037892-86037914 AATCTTGACATTCTTCTCCATGG - Intergenic
1143247109 17:5496270-5496292 AACCTCCACCTCCGCCTCCCAGG - Intergenic
1143332400 17:6147367-6147389 AGGCTTCACCCTCTTCTTCCTGG + Intergenic
1143457144 17:7075722-7075744 AGCCCTCACCTGCTCCTCCCTGG + Exonic
1143730533 17:8880387-8880409 ATCCTTCTCCTTCTACTGCCAGG + Exonic
1143840378 17:9727046-9727068 AACCTCCACCTCCACCTCCCGGG + Intronic
1145764569 17:27449502-27449524 AACCCTCACCTTCTTCAGGCCGG - Intergenic
1148056932 17:44804702-44804724 CACTTTGGCCTTCTTCTCCCGGG + Exonic
1148057441 17:44808996-44809018 AACCTCCACCTCCCCCTCCCAGG - Intronic
1148894059 17:50829926-50829948 CACCATGACCTTCTCCTCCCGGG + Intergenic
1148896088 17:50840013-50840035 ATCCTCCAACTGCTTCTCCCAGG - Exonic
1149351138 17:55788898-55788920 TACCCTCACCTTTTTCTCCCAGG + Intronic
1150478911 17:65494665-65494687 AACCTGGACCTGCTTGTCCCAGG + Intergenic
1151624455 17:75267909-75267931 ACCCTTCACCTTCCTCTCCCTGG - Intronic
1152931295 17:83111528-83111550 AGCCTTCACCCTCTTCTCTCAGG - Intergenic
1155175545 18:23298297-23298319 ACGCTTCACCTTCTTCCCCAAGG - Intronic
1155815767 18:30307640-30307662 AACCGTAACCTTCACCTCCCGGG + Intergenic
1156370003 18:36464752-36464774 AACCCTCTCCTCCTCCTCCCAGG - Intronic
1157312122 18:46560381-46560403 GTCCTTCTCCTTCTTCTTCCGGG + Intronic
1157424360 18:47572095-47572117 GATCTCCACCTTCTGCTCCCTGG + Intergenic
1158450583 18:57560567-57560589 AACCTTAACCTTCTGGGCCCAGG - Intronic
1159519536 18:69500317-69500339 AACCTTCCCATTCTTCTGCATGG + Intronic
1161272643 19:3398543-3398565 AACCATCACCTTCTTCTGCCTGG + Intronic
1163166121 19:15499425-15499447 AATCTCCACCTCCTTCTACCAGG - Intergenic
1163478941 19:17543177-17543199 AACCTCCTCCTCCTTGTCCCAGG - Intronic
1163931466 19:20397191-20397213 CACCTTCACCTCCATCTCCCAGG - Intergenic
1164150344 19:22544969-22544991 AACCTCCACCTCCACCTCCCGGG - Intergenic
1165803735 19:38567936-38567958 CACCTGAACCTTCTTCTCCCCGG + Intronic
1166172447 19:41039234-41039256 AACCTCCTCCTCCTCCTCCCAGG - Intergenic
1166744286 19:45133157-45133179 AACCTCCACCTCCACCTCCCGGG + Intronic
1167153649 19:47724898-47724920 AACCTCCACCTCCACCTCCCAGG - Intronic
1167262295 19:48465938-48465960 CACCTTCACCTTCACCTTCCAGG - Exonic
1168705798 19:58469706-58469728 AACCTGCACCTCCTCCTCACAGG + Exonic
925131210 2:1495437-1495459 TACCTTCAGCTTCTTCCTCCAGG - Intronic
925864377 2:8213370-8213392 AACCTGCACCTCCTCCTTCCAGG - Intergenic
925918324 2:8623054-8623076 AACCTTCTCCTCCTCCTCCTGGG + Intergenic
926369841 2:12168671-12168693 AAAGTTCACCTTCTTCTCTCTGG - Intergenic
926761903 2:16285468-16285490 ACCCTCCACCCTCTCCTCCCAGG - Intergenic
927276067 2:21263474-21263496 ACCCCTCCCCTTCTTCTCCAAGG - Intergenic
927343516 2:22009887-22009909 TACCTTTACCTCCTTTTCCCAGG - Intergenic
927915258 2:26931588-26931610 AAACTTCACCATCTCCTCCAAGG - Intronic
928947689 2:36786616-36786638 AATCTTCTCCTTCATTTCCCTGG - Intronic
929829346 2:45334627-45334649 AACCTCCACCTTCTGAACCCAGG - Intergenic
930069598 2:47355461-47355483 AGCCTTGACCTTCACCTCCCAGG + Intronic
930651317 2:53967564-53967586 AACCTCCACCTCCACCTCCCTGG - Intronic
932451552 2:71813792-71813814 AACCTTGACCCTCTTCTGCTTGG + Intergenic
932724944 2:74171204-74171226 AACCTCCACCTCCACCTCCCGGG - Intronic
933821195 2:86113727-86113749 AACCTCCACCTCCACCTCCCAGG - Intronic
934076754 2:88435163-88435185 AACCTCCACCTCCACCTCCCGGG + Intergenic
934685268 2:96316657-96316679 AACCTCCAACTTCAACTCCCGGG + Intergenic
936508570 2:113127752-113127774 CACCCTCACCTTCTCCTCCTTGG - Intronic
936813822 2:116435154-116435176 GACGTTCACCTTCTACTCCCTGG + Intergenic
937317074 2:120938378-120938400 AACCTTCTTATTCTGCTCCCAGG + Intronic
939301219 2:140341937-140341959 AACTTTCCCTCTCTTCTCCCTGG - Intronic
939423572 2:142004768-142004790 AGCCTTCACCTTCTCTTCCCGGG - Intronic
941901663 2:170684530-170684552 AACCTTTGCCTTCTCCTCCAGGG - Intergenic
941912211 2:170774645-170774667 AACCTTCACCTTCACCTCCCGGG + Intergenic
946413271 2:219526289-219526311 GCCCTCCACCTCCTTCTCCCTGG - Intronic
947302297 2:228701730-228701752 AATCATTACCTGCTTCTCCCAGG + Intergenic
947878757 2:233486410-233486432 AACCCTCAGGTTCTTCTCCCTGG - Intronic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948795876 2:240401874-240401896 CTTCTTCTCCTTCTTCTCCCAGG - Intergenic
949043468 2:241859653-241859675 AGCCTTGACCTTCTTCCCCGGGG + Intergenic
1168869622 20:1117417-1117439 AACCTCCACCTCCACCTCCCGGG + Intronic
1170317923 20:15062544-15062566 AACCTTCACTTTCTACTCCAAGG - Intronic
1170661756 20:18348602-18348624 TACCTTCACCTGCTGCTCACTGG + Intergenic
1170893619 20:20395766-20395788 AACCTTCACCCTCCTCTGCTAGG - Intronic
1171440104 20:25153215-25153237 GCCCTTCACCTTCTTATACCTGG - Intergenic
1171459403 20:25290459-25290481 AACCTTCACCCTCTCCTTCCAGG + Exonic
1172146135 20:32759821-32759843 AACCTTCTGCTTTTTCTTCCTGG + Intergenic
1172427039 20:34862657-34862679 AAATTTCACCCCCTTCTCCCTGG - Intronic
1174713444 20:52731290-52731312 AACCTTCTCCTTTGTTTCCCTGG - Intergenic
1175349943 20:58310209-58310231 ACCCTTCCCCTTCCCCTCCCTGG + Intronic
1178522352 21:33296870-33296892 AACCTCCTCCTCCTCCTCCCGGG - Exonic
1179537694 21:42062990-42063012 AACCGTCCCCTGCCTCTCCCAGG + Intronic
1179581043 21:42344181-42344203 AACCTCCACACTCTTCACCCGGG + Intergenic
1182554367 22:31121128-31121150 AACCTCCACCTCCACCTCCCAGG + Intergenic
1182711694 22:32327338-32327360 AACCTTCATCTTTTGCTTCCTGG + Intergenic
1183224083 22:36537382-36537404 CACCTACACCTGCTTCTCCATGG - Intergenic
1183867526 22:40715524-40715546 AACCTCCACCTCCACCTCCCGGG - Intergenic
1183916850 22:41127792-41127814 CACATTTTCCTTCTTCTCCCTGG - Intronic
1184399224 22:44264125-44264147 AACCTTCATCTTTTGCTTCCTGG + Intronic
1184737352 22:46407020-46407042 AACACTCACCCTGTTCTCCCAGG - Intronic
1185394562 22:50580082-50580104 AATGTCCACCTTATTCTCCCAGG - Exonic
1185408438 22:50670919-50670941 CCCCTCCACCTTCCTCTCCCAGG - Intergenic
950265499 3:11570062-11570084 AACCTTTACCTGCTGCCCCCTGG + Intronic
950696531 3:14704998-14705020 AACCTTCATCCTTCTCTCCCTGG + Intronic
951425687 3:22542601-22542623 ATCCTTCTGATTCTTCTCCCTGG + Intergenic
951668940 3:25159243-25159265 AACCTCCACCTCCCCCTCCCCGG + Intergenic
953126036 3:40092570-40092592 AACCTTCACCTTCCCTTCACAGG - Intronic
953432422 3:42851013-42851035 CACCTTCAGCTTCTTCATCCTGG - Intronic
953540992 3:43818036-43818058 AACCTCCACCTTGTGCTTCCAGG + Intergenic
953705639 3:45227768-45227790 AAAATTCACATTGTTCTCCCTGG - Intergenic
954651903 3:52170088-52170110 CACCTTCAGCTCCTCCTCCCAGG - Intergenic
955427366 3:58806394-58806416 CACCTTCTCCTTCTAATCCCCGG - Exonic
957051349 3:75414714-75414736 AACCTTTACTTCCTTCTTCCTGG - Intergenic
959050500 3:101520118-101520140 AGCCTTGACCTTCTTATCTCAGG - Intergenic
959292789 3:104495682-104495704 ATCCTTTTCCTTCTGCTCCCTGG + Intergenic
959840689 3:110970734-110970756 AACATTTACATTCTTCTCCTGGG - Intergenic
960226417 3:115174374-115174396 CACCTCCACCTTCACCTCCCGGG - Intergenic
960271186 3:115676308-115676330 ACCCTCCCCCTTCTTCTCCTCGG - Exonic
960630939 3:119729737-119729759 TACCTTCAACTTGTTCTCCTTGG - Intronic
961555665 3:127695190-127695212 AACCCTCTCCTTCTTCCTCCAGG - Exonic
962353917 3:134677659-134677681 CATCTTCTCCTCCTTCTCCCTGG + Intronic
964398065 3:156268439-156268461 AACCTTCAAATTATTCTCCATGG + Intronic
965337924 3:167450684-167450706 AATAAGCACCTTCTTCTCCCAGG + Intronic
965750485 3:171970209-171970231 CACTTCCACCTTCTCCTCCCGGG - Intergenic
967222165 3:187256568-187256590 AACCTTCACCTTCTTCTCCCAGG - Intronic
967553994 3:190833401-190833423 AACCTCCACCTCCACCTCCCGGG + Intergenic
967620248 3:191624679-191624701 AGCTTTCACCTTCTCCTCCTTGG - Intergenic
968080671 3:195844367-195844389 AACAATTACCTTCTTCTCCAGGG - Intergenic
968833775 4:2948017-2948039 GACCTTCACCTTCATCTCACAGG - Intronic
969318976 4:6399577-6399599 AACATTCACCTCACTCTCCCAGG + Intronic
970363977 4:15339933-15339955 AACCTCCCACTCCTTCTCCCAGG - Exonic
975098910 4:70490025-70490047 AACATTGACCTTCTTCCCACAGG + Intergenic
975581276 4:75909161-75909183 CACCTTCACCTCCACCTCCCAGG + Intergenic
976850348 4:89537763-89537785 AACTTCCACCTTTTTCTGCCTGG + Intergenic
980265069 4:130504333-130504355 AACCTTCACCATCGTGTCTCAGG + Intergenic
983230355 4:165124078-165124100 AACCTTCACCTTCTGGGCTCAGG + Intronic
983471038 4:168154919-168154941 AATCATCACATTCTTCTGCCTGG + Intronic
983777040 4:171621220-171621242 AACATTAAGCTTATTCTCCCTGG - Intergenic
984196773 4:176666573-176666595 AACCTCCATCTTCCTCTCCCAGG - Intergenic
984920285 4:184758005-184758027 AACTTTCATCATATTCTCCCAGG - Intronic
986565155 5:9105669-9105691 AACCATCACCGCCTTCTCCAAGG + Intronic
986743543 5:10724912-10724934 AACCCCCACCTTCTCCTCCTGGG - Intronic
987748419 5:22007724-22007746 TAACTTCACCATCTTCTTCCTGG - Intronic
987944830 5:24591990-24592012 AACCTTCACTCTCTATTCCCAGG + Intronic
988485653 5:31666196-31666218 AACCATGTCCTTCTCCTCCCTGG - Intronic
989642899 5:43600622-43600644 AATCTTAGCCCTCTTCTCCCAGG - Intergenic
989995786 5:50828807-50828829 CACCTTCACCTTCACCTCCCGGG - Intronic
990190335 5:53252775-53252797 TGCCTTCATCTTCTTGTCCCTGG - Intergenic
990579495 5:57154184-57154206 AACCTCCACCTCCACCTCCCAGG - Intergenic
991261721 5:64675422-64675444 AACCTCCACCTCCACCTCCCGGG + Intergenic
991768595 5:70017511-70017533 TAACTTCACCATCTTCTTCCTGG - Intergenic
991847833 5:70892593-70892615 TAACTTCACCATCTTCTTCCTGG - Intergenic
994085383 5:95752824-95752846 TACGTTCACCTTCATCTCCTGGG - Intronic
994739608 5:103601493-103601515 AACATTCACCTTTTTTTCCATGG - Intergenic
994911658 5:105917234-105917256 GACCTTCACCTGCAACTCCCTGG + Intergenic
995143790 5:108763602-108763624 AGCCTTCTCCTTCCCCTCCCTGG - Intronic
996365937 5:122701591-122701613 TACCTCCACCTGTTTCTCCCTGG + Intergenic
998005941 5:138657088-138657110 CACCTTCCCCTCCTCCTCCCTGG - Intronic
998772384 5:145560888-145560910 ATCTTTGACCTTCATCTCCCTGG + Intronic
999021567 5:148171764-148171786 AAGCTTCACATTCTGGTCCCCGG - Intronic
999757548 5:154676207-154676229 GGCCTCCACCTTGTTCTCCCTGG + Intergenic
999775487 5:154809779-154809801 AACCTCCACCTCCACCTCCCGGG + Intronic
1000229305 5:159300044-159300066 AACCTTCATGTTGTTCTCCAGGG + Intergenic
1001901425 5:175433724-175433746 AACCCTCACCTTATTGCCCCTGG + Intergenic
1002887962 6:1312585-1312607 GATCTTCGCCTTTTTCTCCCGGG - Exonic
1004623477 6:17352300-17352322 AACCTTCATCCTCTTCTCCAAGG - Intergenic
1005434067 6:25788761-25788783 ATCCTTCTCATTCTTTTCCCAGG - Intronic
1006180078 6:32149314-32149336 GAACTTCTCCTTCATCTCCCTGG - Exonic
1007703796 6:43779421-43779443 AACATTCAACTTTTTCTCCCTGG - Intronic
1007787721 6:44290829-44290851 TCCCTTCTCCTTCTTCTCCTGGG + Intronic
1008196790 6:48534184-48534206 AACCTCCCCCTTATTCTCTCGGG - Intergenic
1009569444 6:65364697-65364719 AAAGTTCAGCTCCTTCTCCCCGG + Intronic
1010849818 6:80759658-80759680 ACATTTCACCTTCTTCTACCTGG + Intergenic
1013000684 6:106019188-106019210 AACCTCCACCTCCACCTCCCAGG - Intergenic
1013477579 6:110523236-110523258 AACCTTCATGTTCTATTCCCAGG - Intergenic
1015200525 6:130574900-130574922 ACCCTTCTCCTTCTTCTGCCTGG + Intergenic
1017409111 6:154150325-154150347 AACCTTCAGGATCTACTCCCAGG + Intronic
1017984560 6:159432258-159432280 AACTTACACCTTATTCTCCTGGG - Intergenic
1019632004 7:2054362-2054384 AACCTTCATCATCTTCACACTGG + Intronic
1019781130 7:2940329-2940351 AACCATCTCCTCCTTCCCCCTGG - Intronic
1020163787 7:5792895-5792917 TAATTTCACCTTCATCTCCCTGG - Intergenic
1020762347 7:12283968-12283990 ATCCTGCACCCTCTTCTACCAGG + Intergenic
1021124168 7:16831381-16831403 AACCTCCACCTCCGCCTCCCAGG + Intronic
1024500435 7:50099865-50099887 TACCTTCTCCATCTTCCCCCAGG + Intronic
1025017532 7:55451099-55451121 TCCCTTCACCTTCTTCTTGCGGG + Intronic
1027002813 7:74665913-74665935 AACCTTCACCTCTGCCTCCCGGG + Intronic
1027288953 7:76681171-76681193 AAACTTCACCTGAATCTCCCAGG - Intergenic
1027946417 7:84750607-84750629 GACCTCCACCTTCTTGTACCTGG - Intergenic
1028552467 7:92084889-92084911 CACTTTCACTTTCTTCTCCTCGG - Exonic
1028979771 7:96954486-96954508 AATCTTCACCTTCTTTTGGCAGG + Intergenic
1029689552 7:102172165-102172187 AACCTCCACCTCCACCTCCCGGG + Intronic
1032016903 7:128385851-128385873 AACCATCACCATCTTCCACCTGG - Intergenic
1032546078 7:132744078-132744100 ATTTTTCACCTTTTTCTCCCTGG - Intergenic
1033124822 7:138698343-138698365 AACCTTCACCTGCATCTCAGTGG - Intronic
1034075538 7:148227482-148227504 TACCTGCACCATCTTCTGCCTGG - Intronic
1034369919 7:150585965-150585987 AATCATTACCTTCTGCTCCCTGG + Intergenic
1034476052 7:151282746-151282768 AACCTGGACCTTCCCCTCCCTGG + Intergenic
1034681451 7:152931573-152931595 TACCTTTATCTTGTTCTCCCTGG + Intergenic
1035230417 7:157462481-157462503 AACCTTCTCGTTCATCTTCCGGG - Intergenic
1035372233 7:158386888-158386910 CACCTTCCCATTCATCTCCCAGG - Intronic
1036689936 8:10939040-10939062 GACCTTTTCCTGCTTCTCCCAGG + Intronic
1037266563 8:17068813-17068835 AACCAACATCTTCTTCTACCTGG - Intronic
1039885819 8:41653592-41653614 ATCCTGCACCTTCCTCTCCCAGG - Intronic
1040416484 8:47200494-47200516 AACCTTGACCCTCTCCTTCCAGG + Intergenic
1040551268 8:48439272-48439294 TGCCTTCACCTTCTCCTTCCTGG + Intergenic
1043392267 8:79803286-79803308 AACCTTCACCTTCACCTCCTGGG - Intergenic
1044322981 8:90826165-90826187 GCTCTTCACCTTCTTCTTCCAGG - Intronic
1045554926 8:103206753-103206775 CTCCTTCACACTCTTCTCCCAGG - Intronic
1047015346 8:120718101-120718123 TACCTTCCCCTTCTGCACCCTGG + Intronic
1047839432 8:128734444-128734466 CATATTCTCCTTCTTCTCCCAGG - Intergenic
1047939782 8:129818105-129818127 AACCTTCAGCTTTCTTTCCCAGG - Intergenic
1048841154 8:138567533-138567555 AACCTTCACCTCCTTTACTCTGG + Intergenic
1051376365 9:16406764-16406786 ATCCTTTACTTTTTTCTCCCTGG + Intergenic
1051783487 9:20716211-20716233 AGCCTTCATCTTCTTCTTCATGG - Intronic
1052129177 9:24820221-24820243 AATATTCATCTTTTTCTCCCAGG + Intergenic
1052204503 9:25822762-25822784 AACCTCCAAATTGTTCTCCCTGG + Intergenic
1053055600 9:34991573-34991595 AACCCACACCTTCTTTCCCCTGG - Intronic
1053072327 9:35108564-35108586 ACACTTCCCCCTCTTCTCCCTGG + Intronic
1055498582 9:76881040-76881062 AACCTCCACCTCCCTCCCCCTGG + Intronic
1056836220 9:89957719-89957741 AAATGTCACCTTCTTCTCCATGG - Intergenic
1057505971 9:95633804-95633826 AACCTTCACCTTCCACCTCCAGG - Intergenic
1058328991 9:103735423-103735445 TTCCTTGACCCTCTTCTCCCAGG + Intergenic
1058505516 9:105662196-105662218 ACCCTTCAGCTTTTTCTCTCTGG - Intergenic
1058886381 9:109324453-109324475 AACCTCCACCTCCTACTCCTTGG - Intergenic
1059942601 9:119372055-119372077 AGTCTTCACCTCCTTCTCCAGGG - Intergenic
1060374814 9:123108480-123108502 CACCTTCACCTTCTCTTCCAGGG + Intergenic
1060664007 9:125422173-125422195 AACAAACACCCTCTTCTCCCAGG - Intergenic
1060889513 9:127179194-127179216 AACCTTCACATCCTGCTTCCAGG - Intronic
1061674221 9:132206756-132206778 CACCTTCAACTGCATCTCCCAGG + Intronic
1186721051 X:12304594-12304616 AATCTACACCTCCTTGTCCCTGG - Intronic
1187966850 X:24620419-24620441 AGCCCTCACCTTCTCCTCCAGGG + Intronic
1188962766 X:36512917-36512939 TGCCGTCACATTCTTCTCCCTGG - Intergenic
1190061970 X:47217567-47217589 ATCCTTCACTTCCTTCTGCCTGG - Intergenic
1190324344 X:49197663-49197685 ACCCTGCCCCTTCCTCTCCCAGG + Intronic
1192669471 X:73124993-73125015 AACCTACTCCAGCTTCTCCCAGG + Intergenic
1193232229 X:79061381-79061403 AACCTCCATCCTCTTCTCCATGG + Intergenic
1194945909 X:100066874-100066896 AAGCTTCACCTGCTTATTCCAGG - Intergenic
1196178154 X:112662976-112662998 AACCTTCACATTCAGATCCCTGG + Intronic
1200822427 Y:7600560-7600582 CACCTCAACCTGCTTCTCCCAGG + Intergenic
1201325428 Y:12751814-12751836 AAACTTCTTTTTCTTCTCCCAGG + Intronic
1202237875 Y:22733457-22733479 CACCTCAACCTGCTTCTCCCAGG - Intergenic