ID: 967222167

View in Genome Browser
Species Human (GRCh38)
Location 3:187256607-187256629
Sequence TGGAAAATCTTGGCTGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222167_967222176 30 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222167_967222174 28 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222174 3:187256658-187256680 GCTCACCTTGATGTAGTCATAGG 0: 1
1: 0
2: 0
3: 5
4: 73
967222167_967222173 6 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222173 3:187256636-187256658 CCAGGACAAGTGTTCATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 122
967222167_967222175 29 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222175 3:187256659-187256681 CTCACCTTGATGTAGTCATAGGG 0: 1
1: 0
2: 0
3: 0
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222167 Original CRISPR TGGAAAATCTTGGCTGAGTT GGG (reversed) Intronic