ID: 967222168

View in Genome Browser
Species Human (GRCh38)
Location 3:187256608-187256630
Sequence CTGGAAAATCTTGGCTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222168_967222175 28 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222175 3:187256659-187256681 CTCACCTTGATGTAGTCATAGGG 0: 1
1: 0
2: 0
3: 0
4: 77
967222168_967222174 27 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222174 3:187256658-187256680 GCTCACCTTGATGTAGTCATAGG 0: 1
1: 0
2: 0
3: 5
4: 73
967222168_967222176 29 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222168_967222173 5 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222173 3:187256636-187256658 CCAGGACAAGTGTTCATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222168 Original CRISPR CTGGAAAATCTTGGCTGAGT TGG (reversed) Intronic