ID: 967222169

View in Genome Browser
Species Human (GRCh38)
Location 3:187256617-187256639
Sequence CTGGAGATGCTGGAAAATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222169_967222173 -4 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222173 3:187256636-187256658 CCAGGACAAGTGTTCATTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 122
967222169_967222174 18 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222174 3:187256658-187256680 GCTCACCTTGATGTAGTCATAGG 0: 1
1: 0
2: 0
3: 5
4: 73
967222169_967222176 20 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222169_967222175 19 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222175 3:187256659-187256681 CTCACCTTGATGTAGTCATAGGG 0: 1
1: 0
2: 0
3: 0
4: 77
967222169_967222179 25 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222179 3:187256665-187256687 TTGATGTAGTCATAGGGGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 103
967222169_967222178 24 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222178 3:187256664-187256686 CTTGATGTAGTCATAGGGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222169 Original CRISPR CTGGAGATGCTGGAAAATCT TGG (reversed) Intronic