ID: 967222171

View in Genome Browser
Species Human (GRCh38)
Location 3:187256627-187256649
Sequence AACACTTGTCCTGGAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222171_967222179 15 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222179 3:187256665-187256687 TTGATGTAGTCATAGGGGCAGGG 0: 1
1: 0
2: 1
3: 5
4: 103
967222171_967222181 28 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222181 3:187256678-187256700 AGGGGCAGGGCACCTCAGGATGG 0: 1
1: 1
2: 1
3: 33
4: 401
967222171_967222175 9 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222175 3:187256659-187256681 CTCACCTTGATGTAGTCATAGGG 0: 1
1: 0
2: 0
3: 0
4: 77
967222171_967222176 10 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222171_967222180 24 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222180 3:187256674-187256696 TCATAGGGGCAGGGCACCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 116
967222171_967222174 8 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222174 3:187256658-187256680 GCTCACCTTGATGTAGTCATAGG 0: 1
1: 0
2: 0
3: 5
4: 73
967222171_967222178 14 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222178 3:187256664-187256686 CTTGATGTAGTCATAGGGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222171 Original CRISPR AACACTTGTCCTGGAGATGC TGG (reversed) Intronic