ID: 967222176

View in Genome Browser
Species Human (GRCh38)
Location 3:187256660-187256682
Sequence TCACCTTGATGTAGTCATAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222171_967222176 10 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222172_967222176 1 Left 967222172 3:187256636-187256658 CCAGGACAAGTGTTCATTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222168_967222176 29 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222167_967222176 30 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222169_967222176 20 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222176 Original CRISPR TCACCTTGATGTAGTCATAG GGG Exonic