ID: 967222176

View in Genome Browser
Species Human (GRCh38)
Location 3:187256660-187256682
Sequence TCACCTTGATGTAGTCATAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967222167_967222176 30 Left 967222167 3:187256607-187256629 CCCAACTCAGCCAAGATTTTCCA 0: 1
1: 0
2: 1
3: 28
4: 256
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222171_967222176 10 Left 967222171 3:187256627-187256649 CCAGCATCTCCAGGACAAGTGTT 0: 1
1: 0
2: 0
3: 32
4: 153
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222168_967222176 29 Left 967222168 3:187256608-187256630 CCAACTCAGCCAAGATTTTCCAG 0: 1
1: 0
2: 1
3: 21
4: 203
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222169_967222176 20 Left 967222169 3:187256617-187256639 CCAAGATTTTCCAGCATCTCCAG 0: 1
1: 0
2: 2
3: 36
4: 237
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85
967222172_967222176 1 Left 967222172 3:187256636-187256658 CCAGGACAAGTGTTCATTGCAGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222176 Original CRISPR TCACCTTGATGTAGTCATAG GGG Exonic
908609554 1:65842026-65842048 TCCCTTCGATGTAGTCATGGAGG + Intronic
910116978 1:83742218-83742240 TCATCTTGATTTATTCATAAAGG + Intergenic
910399227 1:86821856-86821878 TCACCTTGATGTTGCCTCAGGGG + Intergenic
911604066 1:99881552-99881574 TCAAGTTGATGAAGACATAGTGG + Exonic
916073925 1:161189129-161189151 CCATCTTCAGGTAGTCATAGGGG + Exonic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
919996483 1:202756173-202756195 TCACTATGTTGTGGTCATAGGGG - Intronic
920745610 1:208625228-208625250 TCACCTGGCTGTCTTCATAGAGG + Intergenic
924183792 1:241465795-241465817 TCACCTTATTGTAGTGATTGTGG - Intergenic
1063740781 10:8816640-8816662 TCACCTTGATGTGGTGACATTGG - Intergenic
1063927429 10:10994340-10994362 TCTCATTGATGTATTCAGAGAGG + Intergenic
1068386756 10:56339195-56339217 TCACCTTGTTGTGCTCAGAGAGG + Intergenic
1068397859 10:56487499-56487521 TCAGCTTGATGTTGTTATACAGG + Intergenic
1076816865 10:132919336-132919358 TCACCTTGACGTTGTCATACAGG + Exonic
1081653164 11:44839229-44839251 TCACCTTGATGCAGTGGAAGGGG + Intronic
1086315020 11:85582035-85582057 CTGCCTTGATGTAGGCATAGAGG + Intronic
1087078711 11:94149937-94149959 AAACCTTGATGTAGTACTAGAGG + Intronic
1091405957 12:209744-209766 TCACTTTGAGGTAGGCATGGTGG - Intronic
1093981122 12:25476969-25476991 TCACCTTGGTGTGGTGATAATGG - Intronic
1095885826 12:47187401-47187423 TCCCCTTGATGTAGAGATGGGGG - Intronic
1097446674 12:59679805-59679827 TTACCTTGATTTAATCATAAGGG + Intronic
1099127800 12:78787665-78787687 TCTTCTTGATCTAGTAATAGAGG - Intergenic
1106448176 13:29855326-29855348 TCAGCTTGATGTAATCATTCCGG + Intergenic
1108588861 13:51894849-51894871 TCACCATGATGTAGAATTAGTGG + Intergenic
1116933917 14:50717767-50717789 TCACCATAATGTAGACTTAGAGG + Intergenic
1121730110 14:96180856-96180878 TCACCTTCCTGTAATCATACAGG - Intergenic
1122969396 14:105146381-105146403 TCACCTTGCTGCAGTCACGGCGG + Exonic
1127476546 15:59339163-59339185 TCAACTTGAAGTAGTAATAATGG + Intronic
1128627466 15:69224560-69224582 TCACATGGGTGTAGTCAAAGAGG - Intronic
1128795660 15:70464771-70464793 TCATCTTGATAAAGTCATGGGGG + Intergenic
1132265333 15:100465401-100465423 TCATCTTCATGGAGTCAAAGGGG - Intronic
1133608567 16:7412072-7412094 TAATCGTGATGTATTCATAGTGG + Intronic
1135168453 16:20161880-20161902 TCTCATTGATGTAATCAGAGAGG - Intergenic
1136184726 16:28580575-28580597 TCACTAAGATGAAGTCATAGTGG - Intronic
1142034076 16:87853056-87853078 TCACCTTCCTGCAGTCTTAGTGG - Intronic
1157707514 18:49819791-49819813 TCACTTTAGTGTAGTCAGAGTGG + Intronic
1164814433 19:31184047-31184069 TGACCGTGATATAGTCATAAAGG + Intergenic
1167257878 19:48442193-48442215 TCACCTCGATTTTGTCATTGTGG - Exonic
1167789998 19:51669555-51669577 TCATCTTAAAGTAGTCATATAGG + Intergenic
926534232 2:14090665-14090687 TCACCTTGCTCTAGGCATACTGG - Intergenic
926924819 2:17976764-17976786 TAACCTTCATGTATGCATAGTGG - Intronic
928243368 2:29605873-29605895 TCACTTTGATTTTGTCAGAGGGG - Intronic
928445961 2:31333387-31333409 TCTCCTTCATGTGGTTATAGGGG + Intergenic
929559629 2:42947893-42947915 TCATCTCCATGCAGTCATAGAGG - Intergenic
930746238 2:54885978-54886000 TCACATTCATGTAGCCATAATGG + Intronic
931430004 2:62201744-62201766 TCAAGTTAATGTAGTTATAGTGG - Intronic
931485594 2:62687780-62687802 TCTCCTTGATCTTTTCATAGCGG - Intronic
934121514 2:88844884-88844906 TCACAGTGATGTTGACATAGAGG + Intergenic
1170870096 20:20197763-20197785 TCAACTTGATGTAGACTTGGGGG + Intronic
949419729 3:3853125-3853147 TCTCCAGGATGTAGTCACAGAGG + Intronic
951408556 3:22332047-22332069 TCAACTTGATGAAGTTATCGTGG - Intronic
955915688 3:63905752-63905774 ACACCTTGATGTAGACGTGGGGG + Intronic
957527856 3:81400292-81400314 CCATCTTGATGTAGGCAGAGGGG - Intergenic
958816441 3:98921385-98921407 GCACCTTCACATAGTCATAGTGG - Intergenic
960225165 3:115159483-115159505 TTACTTTGATGTATACATAGTGG + Intergenic
964414929 3:156437515-156437537 TCACTTTGATGGGGTCAGAGTGG - Intronic
967222176 3:187256660-187256682 TCACCTTGATGTAGTCATAGGGG + Exonic
971528934 4:27660058-27660080 TCACCTTCCTCTAGTCACAGTGG + Intergenic
982195389 4:152906795-152906817 TCACTCTGCTGCAGTCATAGAGG + Intronic
983641627 4:169948800-169948822 TCACCCTGAAGCAGTCCTAGGGG - Intergenic
988820406 5:34878641-34878663 TCATCTTACTGTAGTCACAGTGG + Intronic
993021612 5:82598163-82598185 TCACCTCTATGTAGTTATATTGG + Intergenic
993825543 5:92681450-92681472 TCACATTCATATAGTGATAGAGG + Intergenic
998069915 5:139189479-139189501 TCACCATAATGTAGACTTAGTGG - Intronic
999984946 5:156994277-156994299 TCACCTTGATTTAGGCTTAGTGG - Intergenic
1003924321 6:10862502-10862524 TCACCTGGAAGTGGTAATAGAGG + Intronic
1005391069 6:25333735-25333757 TCATTTTTTTGTAGTCATAGTGG + Intronic
1006130370 6:31865494-31865516 TCACCATGATGTATGCATTGCGG + Exonic
1014408519 6:121083936-121083958 TCACCTTGTTCTGGTCACAGTGG + Intronic
1016175766 6:141075937-141075959 TCAGCTTGATGCTGTCACAGAGG + Intergenic
1018596567 6:165487404-165487426 TCACCATGATGTAGAATTAGTGG - Intronic
1023276804 7:38528443-38528465 TCACCTTGATTAAGTTTTAGTGG + Intronic
1024106991 7:46100382-46100404 TTACCTTAATTCAGTCATAGAGG + Intergenic
1029039470 7:97557653-97557675 CTACCTTCATGCAGTCATAGAGG - Intergenic
1030284247 7:107809295-107809317 TCACCATGATGAAGGCATACAGG - Intergenic
1032883654 7:136115757-136115779 TGACCTTGGTGGAGGCATAGGGG + Intergenic
1034147805 7:148887728-148887750 TCCCATTGAAATAGTCATAGAGG - Intergenic
1038716203 8:29993479-29993501 TCTCCTTGACACAGTCATAGTGG + Intergenic
1046021062 8:108665434-108665456 TCTCCTTGTTGTAGGCAAAGGGG - Intronic
1048685781 8:136903968-136903990 TCACTTTGCTGTAGTCACATTGG - Intergenic
1051734961 9:20188607-20188629 TGGGCTTGATGTAGTCACAGTGG + Intergenic
1055759622 9:79592619-79592641 TTACCTTTATATAGACATAGTGG + Intronic
1056648233 9:88433507-88433529 TCATCTTGATGTCTTCCTAGAGG - Intronic
1061667105 9:132166966-132166988 TCACCTTGACGTAGTCCTTCAGG - Exonic
1062216384 9:135391958-135391980 GCACCTGGATGTAGGCACAGAGG - Intergenic
1186257698 X:7740550-7740572 TCTGCTTGATGGACTCATAGAGG + Intergenic
1186934306 X:14430574-14430596 TCAGCTTGTTGTACTCATGGGGG + Intergenic
1198215926 X:134554752-134554774 TCACCTTGATGACATCATGGTGG - Intergenic