ID: 967222909

View in Genome Browser
Species Human (GRCh38)
Location 3:187263622-187263644
Sequence TTAATACAGAAACTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 1, 2: 7, 3: 49, 4: 515}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967222909 Original CRISPR TTAATACAGAAACTATTTAT TGG Intronic
900734940 1:4293611-4293633 TTAACTCATCAACTATTTATTGG - Intergenic
901093359 1:6658712-6658734 TTTATAGAGAAATTCTTTATAGG + Intronic
902352031 1:15863525-15863547 TTATATTAGAAACTATTTATTGG - Intronic
902819630 1:18936089-18936111 TTAATCCAGTGAATATTTATGGG - Intronic
903430636 1:23295914-23295936 TTAAAAAAGAAAATGTTTATGGG + Intergenic
903988245 1:27245319-27245341 TTCATTCAGCAAATATTTATTGG + Intronic
904044344 1:27601221-27601243 TTACTACAGAAAATAAATATCGG + Intronic
905248353 1:36630049-36630071 TTAGTAAAGAGACTATTTACAGG - Intergenic
905411192 1:37769589-37769611 TTAAGAGAGAACCTATCTATTGG + Intergenic
905483744 1:38280877-38280899 TTGATTCAACAACTATTTATGGG + Intergenic
905759969 1:40547812-40547834 TTACTGCAGAAACTGTTAATAGG - Exonic
905812352 1:40921923-40921945 TTACTACAGCAACTCTTCATTGG + Intergenic
906014933 1:42567829-42567851 TTAATCCAATAAATATTTATAGG - Intronic
906162618 1:43661761-43661783 ATAATACAGGACCTAGTTATGGG + Intronic
906332480 1:44898451-44898473 TTTATTCAACAACTATTTATTGG - Intronic
908192804 1:61720733-61720755 TTTATTGAGAAAGTATTTATTGG - Intronic
909115486 1:71529477-71529499 TTAATCCTAAAATTATTTATTGG - Intronic
909247631 1:73307866-73307888 CTAAGTCAGAAACTGTTTATAGG + Intergenic
909301444 1:74017819-74017841 CTAATACAGAGAATATTTACGGG - Intergenic
909764617 1:79339975-79339997 TTAATACAGACACAGTTTACAGG - Intergenic
909772317 1:79439570-79439592 TTTATTCAGCAAATATTTATTGG - Intergenic
910038238 1:82814748-82814770 TTGATTCAGTAAATATTTATTGG - Intergenic
910054573 1:83016845-83016867 TAAATACCGAAATTATTTAATGG - Intergenic
910278606 1:85474214-85474236 TTAGTCCAGAAAATAATTATTGG + Intronic
910287651 1:85573496-85573518 ATAACACAGAAACATTTTATTGG - Intronic
911682324 1:100731684-100731706 TTAAAATAGTAACTATTTACTGG + Intronic
911870277 1:103088557-103088579 TTCATAAAGAAAGTTTTTATTGG + Intronic
912529926 1:110312848-110312870 TTAATTCAGCAAATATTTACAGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913170951 1:116231793-116231815 TGAATACAAAGACTATTTAATGG + Intergenic
914731846 1:150378675-150378697 TTAATTAAGAAATAATTTATTGG + Intronic
915620270 1:157078298-157078320 TTAATTCAACAAGTATTTATGGG - Intergenic
916287259 1:163121903-163121925 TTAATTGACAAACAATTTATGGG - Intronic
916376851 1:164164583-164164605 TTAGTAAAGAAATGATTTATTGG + Intergenic
916920853 1:169464899-169464921 TTAATATAAAAACTATAAATAGG + Exonic
918393802 1:184093859-184093881 TTCAAATTGAAACTATTTATAGG + Intergenic
918889789 1:190251859-190251881 TAAATAAGGAAACTATTTGTTGG - Intronic
919445126 1:197694080-197694102 TTAATAGATAAACGATTTAAAGG - Intronic
919771336 1:201160987-201161009 TTAATACTGCAAATATTGATAGG - Intronic
920058693 1:203212829-203212851 TTCATTCAGTAACTATTTATTGG + Intronic
920603378 1:207353014-207353036 GTAATAGAGAAACTAGTCATCGG - Intronic
921029978 1:211327910-211327932 TTAATTCTGTAAATATTTATTGG + Intronic
921806731 1:219463510-219463532 TTAAGATGGAAACTATTTATTGG + Intergenic
921896877 1:220411046-220411068 TAAATTCAGAAACTCTATATTGG + Intergenic
922409845 1:225362016-225362038 TTCATCCAAAAACTATTTATAGG + Intronic
922920602 1:229299649-229299671 TTACTAAAGTAACTATATATGGG + Intronic
923955592 1:239015044-239015066 TCAATACAGAACCTAATTTTTGG - Intergenic
924662255 1:246031863-246031885 TTAATTCAGAAACAATATTTAGG + Intronic
924875351 1:248097227-248097249 TTAATACAGAAAGTTTATTTGGG - Intronic
1063837033 10:10027159-10027181 TTAATTCAGCAAATATTTGTTGG + Intergenic
1064383520 10:14868646-14868668 TTTATACAGAAAATATCTATAGG + Intronic
1064585449 10:16835016-16835038 TGAATGCAGAAACGATTTCTTGG - Exonic
1065152094 10:22832300-22832322 TCAATTCAGGAAATATTTATTGG + Intergenic
1065446493 10:25807138-25807160 TTTAAATAGAAAATATTTATAGG - Intergenic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1066546007 10:36501446-36501468 TTAATACATAAATTCTGTATGGG + Intergenic
1067323230 10:45241935-45241957 TGAATGCAGAAACGATTTCTTGG - Intergenic
1068517206 10:58039252-58039274 TTAATAAAGAAATGATTTTTAGG - Intergenic
1069201568 10:65624236-65624258 TTAAAACAGAAAATAAATATAGG + Intergenic
1069498050 10:68924833-68924855 TTAATTTAGAAAGTTTTTATAGG + Intronic
1070221045 10:74445302-74445324 TTAATACTGAAATTAATTATAGG - Intronic
1071312879 10:84360211-84360233 TTAAAACTGAAACTATTAAAAGG - Intronic
1071856452 10:89630224-89630246 CTTATAAATAAACTATTTATTGG - Intronic
1072560911 10:96572942-96572964 TTACTAAAGAGACTATTTAAAGG - Intronic
1073945335 10:108743579-108743601 TTAATACAGGAATTATTGTTAGG + Intergenic
1074138987 10:110654706-110654728 TTCATACACAAAATATGTATGGG + Intronic
1074718907 10:116247961-116247983 TTAAAACAGAAACTATTACAGGG - Intronic
1074960534 10:118441291-118441313 TTAATAAAGAAAATAATTATTGG + Intergenic
1075434622 10:122426033-122426055 GTAATACAGACACAATTTACTGG - Intronic
1075868940 10:125753891-125753913 TTAGTAGAGAAAATTTTTATAGG - Intronic
1078661785 11:13293370-13293392 ATAATAAAGCAAATATTTATGGG - Intronic
1078945346 11:16060956-16060978 TTAAATCAGAAACTATTGATTGG - Intronic
1079534770 11:21500327-21500349 TTATTACAGAAAATATTTTTGGG - Intronic
1079942607 11:26700370-26700392 TCCATTCAGAAAGTATTTATTGG + Intronic
1080332583 11:31156565-31156587 TTAATACAAAAAGTATTAATGGG + Intronic
1081028802 11:38051204-38051226 TTAATACAATAACAATTTAGTGG - Intergenic
1082157461 11:48842659-48842681 TTCATATAGAAACTATTCAGAGG + Intergenic
1082227069 11:49720575-49720597 TTCATTCAGAAAATATTTATTGG - Intergenic
1082746712 11:56970426-56970448 TTATTACAGAAATTATGTAGTGG - Intergenic
1084639963 11:70419605-70419627 ATAATACAGACAGTATTTAAAGG - Intronic
1085273720 11:75285086-75285108 TTAATGCAGAATTCATTTATTGG - Intronic
1085569340 11:77545820-77545842 TTATAACAGAAAGTATTGATGGG + Intronic
1085591772 11:77769420-77769442 TTAGGACAAAAACTATTTTTTGG - Intronic
1086622357 11:88902511-88902533 TTCATTCAGAAAATATTTATTGG + Intronic
1086935842 11:92745176-92745198 TTACAACAGAAAGTATATATTGG - Intronic
1086942312 11:92811201-92811223 TTAAAAAAGAGACTATTTGTAGG - Intronic
1087088918 11:94248058-94248080 TTAATACAGAAACCACTAAGAGG + Intergenic
1088193560 11:107252204-107252226 TGAATACAGAAAACATTGATGGG - Intergenic
1089064842 11:115654730-115654752 TTTATTCAGAAAATATTTATTGG - Intergenic
1089977515 11:122745351-122745373 TTCATTCAGCAAGTATTTATGGG + Intronic
1090114405 11:123952850-123952872 TGAATCCAGAAACTGTTTCTTGG + Intergenic
1090161737 11:124502345-124502367 TTATTACAGAAACTCTTCCTAGG - Intergenic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1092304906 12:7290285-7290307 TTAATAAAAAAAAAATTTATAGG - Intergenic
1092569235 12:9704243-9704265 TATATACAGAAAATATTTATTGG - Intergenic
1095653278 12:44639309-44639331 TTCATAAAGAAAATATTTGTGGG - Intronic
1095847793 12:46764789-46764811 TTATTACAGAAAGTGTATATTGG - Exonic
1096301914 12:50436315-50436337 TTATTACAGAAGCTGTATATAGG - Intronic
1096316264 12:50569185-50569207 ATAATAGAGAAACTAGTTAATGG + Intronic
1097393671 12:59046933-59046955 TAAATACTTGAACTATTTATGGG - Intergenic
1097414248 12:59295048-59295070 TTTATCCAGAAAATATTTATTGG + Intergenic
1097813379 12:64043894-64043916 TTAATTCAAAATATATTTATTGG + Intronic
1097867685 12:64572642-64572664 TTAATTTAGTAAATATTTATTGG - Intergenic
1098027992 12:66225599-66225621 TTAATTCAAAAATTACTTATGGG - Intronic
1098035221 12:66294859-66294881 TTAATATAAAAACAATGTATTGG + Intergenic
1098049214 12:66435506-66435528 TTAAAACAGAAAATATTAAATGG - Intronic
1098935742 12:76477275-76477297 TTAATTCAGAAAATATTACTAGG - Intronic
1099160114 12:79230143-79230165 TTTATACAGAAAATAGTTTTAGG - Intronic
1099212307 12:79806782-79806804 TTAGTAAAGAAATTGTTTATAGG + Intronic
1099645600 12:85350707-85350729 TTAATTCAGAAACTATAGTTAGG - Intergenic
1100319903 12:93480834-93480856 GGAATACAGAAATTATTTGTCGG - Intronic
1100429608 12:94518912-94518934 CTAATACAGATACTATCTTTTGG - Intergenic
1100900400 12:99233893-99233915 TTTATAAACAAAATATTTATTGG - Intronic
1101259046 12:103010505-103010527 TTAATTCAAAAAGTGTTTATTGG - Intergenic
1102420749 12:112800999-112801021 TTAATCCAGCCACTATTCATGGG - Intronic
1102514673 12:113438254-113438276 TCAATTCAGAAAGTGTTTATTGG - Exonic
1103767883 12:123295441-123295463 TAAATATAGAAAATATATATTGG - Exonic
1105390283 13:19970662-19970684 TTCATTCAGTAAATATTTATTGG + Intronic
1106613097 13:31301990-31302012 TGAATACAGAAAACATTCATAGG - Intronic
1106775599 13:33005623-33005645 TAATTACAGGAACTCTTTATAGG + Intergenic
1106858585 13:33880120-33880142 GTAATATAAAACCTATTTATAGG + Intronic
1107798128 13:44075933-44075955 TCAATACAAAAATTATTAATGGG - Intergenic
1108024765 13:46166134-46166156 TGAATATAGAAACAATTTGTGGG + Intronic
1108313496 13:49217774-49217796 TGAGTACAGAAACTATTTTGAGG + Intergenic
1108472010 13:50776871-50776893 TTTAAACAGAGACTACTTATTGG + Intronic
1108785426 13:53895276-53895298 TTTATACATAAACTATTACTTGG - Intergenic
1109035034 13:57246671-57246693 TTAATACAAAATCTATTTTTAGG + Intergenic
1109220702 13:59638346-59638368 TTAACAGAAAATCTATTTATAGG - Intergenic
1109275314 13:60297571-60297593 GTAATAAAGAAAGTTTTTATTGG - Intergenic
1109604519 13:64675073-64675095 TTAATACAAAACCCTTTTATGGG - Intergenic
1109637418 13:65140884-65140906 TTAATACAGAAAGTTTTATTAGG + Intergenic
1109686957 13:65832621-65832643 TAAATGCAGAAATGATTTATGGG + Intergenic
1109866006 13:68263908-68263930 AGAATACAGAAACTAGCTATAGG + Intergenic
1110123353 13:71910288-71910310 TGAATTCAAAAAATATTTATTGG + Intergenic
1110194118 13:72766420-72766442 TTACTACAGAAAACAGTTATTGG + Intronic
1110504188 13:76266115-76266137 TTACTGCAGAAAAAATTTATAGG + Intergenic
1111037271 13:82692746-82692768 TTAATACAGTAATTATTTTTGGG - Intergenic
1111516667 13:89342118-89342140 TTATTTCATAAACTATTTTTTGG - Intergenic
1111885965 13:94020860-94020882 TTACTACAAAGCCTATTTATAGG + Intronic
1111918450 13:94385705-94385727 TTAATTCAGCAAGTCTTTATTGG - Intronic
1111965639 13:94858860-94858882 TTTATTCAGTAACAATTTATTGG - Intergenic
1112092586 13:96097452-96097474 TTCATACTGAACCTATTTCTTGG - Intronic
1112520747 13:100092886-100092908 TTATTACAGAAACTAGTTTCTGG + Intronic
1112765657 13:102739762-102739784 TGAATAAAGAAACAATTGATGGG - Exonic
1112984556 13:105431818-105431840 ATAATTCAGAAACCATTTATCGG + Intergenic
1112989830 13:105499246-105499268 AGAATACAGAAAATATTCATGGG - Intergenic
1112991092 13:105514751-105514773 TTATTCCAGAAAATATTTAAAGG - Intergenic
1113646567 13:112001289-112001311 TTAATACAGTAAATATTTATAGG - Intergenic
1115282606 14:31680723-31680745 GTAATACAGCAATTATTTAAAGG - Intronic
1116072797 14:40070765-40070787 TTAATTCAGTAAGTATTCATTGG + Intergenic
1116425720 14:44788089-44788111 TTAAGACAAAAATTATTTATTGG + Intergenic
1116572809 14:46539271-46539293 TGAATGAAGAAACAATTTATTGG + Intergenic
1117227363 14:53676629-53676651 ATAATAAAGAAAATATTTAGAGG - Intergenic
1118102238 14:62619704-62619726 GTAAAACTGAAGCTATTTATAGG - Intergenic
1119420955 14:74507843-74507865 TCAATACATACACTATTTGTTGG + Intronic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120698737 14:87674243-87674265 TTAATACACAAAAGATTTTTAGG - Intergenic
1121455146 14:94033825-94033847 CTAATACAGCAAATATTCATAGG - Intronic
1121842123 14:97143481-97143503 TTGAAACAGAATCTATTTTTAGG + Intergenic
1121956906 14:98222644-98222666 TTAATACAAAAACCATGTTTGGG + Intergenic
1126193832 15:45908779-45908801 CTAATTCAGAAATTATTTAAAGG - Intergenic
1126391890 15:48166028-48166050 TTAATAGGGAAAAAATTTATAGG + Intronic
1126824768 15:52538103-52538125 TTTGTCCAGAAAGTATTTATTGG + Intergenic
1127219036 15:56858385-56858407 TTTATACTGAAAATATTTCTGGG + Intronic
1127536412 15:59893895-59893917 TTAATTCAACAACTATTTACAGG + Intergenic
1129616480 15:77102693-77102715 TTCATACTGATACTATTTTTAGG + Exonic
1130814115 15:87412792-87412814 TTAATACAAAACCTATTTAATGG + Intergenic
1131046240 15:89318157-89318179 TTAAGAAAGAAAACATTTATGGG + Intronic
1131330375 15:91492902-91492924 ATAATACATATACTATATATGGG - Intergenic
1131380024 15:91955776-91955798 TTAATAAAGAAACAAGTAATTGG + Intronic
1131854337 15:96577278-96577300 TTCATTCAGAAAATATTTATTGG - Intergenic
1131883316 15:96881797-96881819 TGTATTCAGCAACTATTTATTGG - Intergenic
1134517281 16:14897275-14897297 TTAATACAGAATCCATTTCTTGG + Intronic
1134704949 16:16295929-16295951 TTAATACAGGATCCATTTCTTGG + Intergenic
1134962592 16:18416185-18416207 TTAATACAGGATCCATTTCTTGG - Intergenic
1134966889 16:18498784-18498806 TTAATACAGGATCCATTTCTTGG - Intronic
1135671089 16:24376192-24376214 TTAATTCAGCAACTGTTTATTGG + Intergenic
1136926423 16:34379321-34379343 GTATTACAGAAAGTATTTAGAGG - Intergenic
1136978151 16:35032486-35032508 GTATTACAGAAAGTATTTAGAGG + Intergenic
1137425287 16:48374274-48374296 TTCATCCAAAAAATATTTATTGG - Intronic
1139147081 16:64338572-64338594 TTAAGACAGAAACAATGTAAAGG + Intergenic
1139807307 16:69578263-69578285 TAACTATAGAAACTATATATCGG - Intronic
1140287417 16:73617585-73617607 TTAATAAAGAAACAATTTTTAGG - Intergenic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1141025950 16:80548397-80548419 TTAAAACAGAAACTATTAAGTGG - Intronic
1144587795 17:16498527-16498549 TTCATTCAGCAAGTATTTATGGG - Intergenic
1145096596 17:20034060-20034082 TTACTTTAGAAACTATTTAAAGG - Intronic
1145716292 17:27025913-27025935 TCAATATAGAAATTATTAATGGG - Intergenic
1149251844 17:54779241-54779263 TTGAGACAGAAAGAATTTATTGG - Intergenic
1149306713 17:55354872-55354894 TAAATTCAGCAAATATTTATTGG - Intergenic
1149763920 17:59259044-59259066 TTAAGAAAGAAATTATTTAAGGG + Intronic
1150514317 17:65791639-65791661 TTACTATAGAAACTCTTTAGGGG - Intronic
1151025754 17:70674440-70674462 TTAATACAGAAAAAAGCTATAGG + Intergenic
1154471337 18:14704946-14704968 TCAATATAGAAATTATTAATGGG + Intergenic
1156132191 18:33989441-33989463 TTAATACAGCATCTATTGAATGG + Intronic
1156914477 18:42448835-42448857 CTAATACAGAAAATTTGTATTGG - Intergenic
1157099349 18:44715383-44715405 TTAATCCAGAAGTTATTTACAGG + Intronic
1158077527 18:53548099-53548121 TTCAGAAAGAAACTATATATTGG + Intergenic
1158167448 18:54556414-54556436 TTAATTCAAGAAATATTTATTGG - Intergenic
1158230997 18:55255091-55255113 TTAATTAAGAAACTATAAATAGG - Intronic
1158266794 18:55667677-55667699 CTAATACAAAAATTATTTGTTGG - Intergenic
1159529213 18:69634624-69634646 TTTATTCAATAACTATTTATTGG + Intronic
1159573487 18:70146804-70146826 TTGATTCAGGAAGTATTTATTGG - Intronic
1160614949 18:80118955-80118977 GTAATACAGAAGTTTTTTATAGG + Intronic
1161890615 19:7033432-7033454 TTAATACAAAAACTAATTAACGG - Intergenic
1161892919 19:7055763-7055785 TTAATACAAAAACTAATTAACGG + Intergenic
925690302 2:6515420-6515442 TTAAAATAGAAACTTCTTATTGG - Intergenic
925742037 2:7014269-7014291 TTCATTCAACAACTATTTATGGG - Intronic
926673612 2:15600158-15600180 TTATAAAAGAAAGTATTTATAGG + Intronic
926986249 2:18627429-18627451 TTCATTCAGGCACTATTTATGGG + Intergenic
927108787 2:19849642-19849664 TTAAAACAGAAAATTTTTAAAGG + Intergenic
927227128 2:20778985-20779007 TTCATACAAACAGTATTTATTGG + Intronic
927468630 2:23355641-23355663 TTAATATAACAAGTATTTATAGG + Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928354801 2:30601579-30601601 TGAATACTGAAAGTATTTGTTGG - Intronic
929368509 2:41192161-41192183 TTCATTCAACAACTATTTATTGG - Intergenic
930449539 2:51517763-51517785 TTAATTCAGAAAGAAATTATTGG - Intergenic
930704444 2:54490401-54490423 TAAATTCAGAAAGTATTTAAGGG + Intronic
930848897 2:55936660-55936682 CTAATAGTCAAACTATTTATGGG + Intergenic
931715527 2:65025808-65025830 TTAAAAGGGAAACAATTTATAGG - Intergenic
933033898 2:77368027-77368049 TTAATACATAAACTCTGTAGTGG + Intronic
933092930 2:78144739-78144761 TTAATAAACTAAATATTTATCGG - Intergenic
933097228 2:78201701-78201723 TTAATATATATACTATTTAATGG + Intergenic
933184422 2:79262864-79262886 TTTACTCAGAAAATATTTATGGG + Intronic
933859736 2:86453962-86453984 GTAATACAGAAACTGTCAATAGG - Intronic
933938274 2:87224754-87224776 TTTATTCACAAACTATTTATTGG - Intergenic
936354861 2:111741021-111741043 TTTATTCACAAACGATTTATTGG + Intergenic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936864324 2:117059215-117059237 CGAATACAGAAAGTTTTTATAGG - Intergenic
937517404 2:122670820-122670842 TTAATGGAGAAACTATAAATCGG - Intergenic
939446082 2:142311431-142311453 TTAATACAGAAAATTGTTACTGG - Intergenic
939520826 2:143228263-143228285 TAAAAACATAAACTTTTTATGGG + Intronic
939886089 2:147683404-147683426 TTTACACAGAAACTCTTTAAGGG - Intergenic
940672221 2:156684658-156684680 TAAATACAGAACCTATTTGTGGG + Intergenic
941464384 2:165808592-165808614 TTCATTCAAAAACTATTTGTGGG + Intergenic
941475059 2:165940809-165940831 TTAAGACAGACACTCTTTTTAGG - Intronic
942353344 2:175078270-175078292 TTATTACTGAAAATATGTATAGG - Intronic
942598879 2:177619708-177619730 TATATACAGAAAAGATTTATGGG - Intergenic
943117651 2:183692883-183692905 GTAAAACTGACACTATTTATTGG - Intergenic
943181710 2:184552276-184552298 TTACTTGAAAAACTATTTATAGG + Intergenic
943263994 2:185702502-185702524 TTAAGACAAAAACGATTTAATGG + Intergenic
943315565 2:186383461-186383483 TTATTAGAAAAACTATTAATAGG + Intergenic
943406036 2:187487094-187487116 TAAATACAGGTACTATTTTTAGG - Intronic
943536495 2:189158048-189158070 AAAATGCAGAAAATATTTATTGG - Intronic
943888956 2:193260653-193260675 TTAAATAACAAACTATTTATTGG + Intergenic
944626771 2:201577971-201577993 TAAATACAGTATATATTTATGGG - Intronic
944932387 2:204532955-204532977 TTACTACAGAAACCACTTACTGG - Intergenic
944946087 2:204687523-204687545 TTAATTCAGTAAGTATTTTTGGG - Intronic
945466225 2:210172674-210172696 TTAAATCAGTAAGTATTTATTGG + Intergenic
945559914 2:211326962-211326984 TGACTGCAGAAGCTATTTATTGG + Intergenic
945624252 2:212181466-212181488 TTCATATTGAAATTATTTATAGG - Intronic
945731229 2:213537924-213537946 TTAATACAGAAAGTATCAGTGGG + Intronic
946832261 2:223738920-223738942 TTAATACAACAAGTATTAATTGG + Intergenic
946993073 2:225358100-225358122 TTAATGCAGAAAATTTTTATAGG + Intergenic
947007777 2:225531887-225531909 TTGGTACACAAACTAATTATGGG + Intronic
949018875 2:241729450-241729472 TTAATAAATAAAGTATTTTTTGG + Exonic
1169368816 20:5012681-5012703 TTAGTACAGACACTCTTCATTGG + Intergenic
1169674905 20:8142406-8142428 TTGAGAAGGAAACTATTTATTGG + Intronic
1169747722 20:8959861-8959883 ATAATATAGAAAATATTTTTTGG - Intronic
1170077283 20:12433417-12433439 TTTACACAGAAGATATTTATAGG + Intergenic
1170187584 20:13608401-13608423 TTAATTCAACAAATATTTATTGG + Intronic
1170243826 20:14198434-14198456 TTGATACAGAAATTATACATTGG - Intronic
1170272486 20:14543410-14543432 TTAATTCATAAACTACATATAGG - Intronic
1171510721 20:25682214-25682236 ATAATACAGTAACTATTATTAGG + Intronic
1171853831 20:30327062-30327084 TTATTACAGAAAAGGTTTATGGG - Intergenic
1172064358 20:32208391-32208413 TTGATTCAGCAAATATTTATGGG + Intronic
1173123320 20:40314098-40314120 TTTATACATAATCTATTTCTAGG - Intergenic
1174124325 20:48291604-48291626 TTAATACACAAACAAATTCTTGG + Intergenic
1174438427 20:50528771-50528793 TTCATTCAGGAACTACTTATTGG - Intronic
1174726234 20:52865172-52865194 TTAATACAAAAAATATTGCTGGG + Intergenic
1175268616 20:57717982-57718004 TTCATTCAGCAAATATTTATTGG - Intergenic
1176275774 20:64267623-64267645 ATTATAGAGAAACTAGTTATAGG - Intronic
1176967655 21:15229461-15229483 GTAATATTGAAAATATTTATTGG - Intergenic
1177490215 21:21814201-21814223 TTAATAAAGTAACCATTTACAGG - Intergenic
1178512898 21:33221295-33221317 TTAAAACACTAACTATTTCTAGG + Intergenic
1178661803 21:34512953-34512975 GTCTTACAGAAAATATTTATTGG + Intergenic
1181642030 22:24206851-24206873 TTAATACTAATAGTATTTATTGG + Intergenic
1182005683 22:26957532-26957554 TTAAAACATAAACTTTTCATTGG - Intergenic
1184752447 22:46495533-46495555 TTTATACAGAAAATTTTTCTTGG + Intronic
949560273 3:5195086-5195108 TTTATTCAGGAACTAATTATGGG - Intronic
949868113 3:8563414-8563436 TTCATTCAGCAACTATTGATGGG + Intronic
949978034 3:9478393-9478415 TTCATTCAGCAACTATTTATTGG + Intronic
951495283 3:23318439-23318461 TTATTAGAGAAACAATGTATTGG + Intronic
952810753 3:37400478-37400500 TTAAAATAGCAACTGTTTATGGG + Intronic
953073679 3:39548205-39548227 TAAAGACAGAAAATGTTTATAGG - Intergenic
953159996 3:40409989-40410011 TTAAAAAAGAAACTACTTACAGG + Intronic
954243075 3:49309390-49309412 TTAATTCATCAAATATTTATTGG - Intronic
955297036 3:57745544-57745566 ATAATACAGAAAAAATATATGGG - Intergenic
955518407 3:59751034-59751056 ACAAAAAAGAAACTATTTATAGG + Intronic
955669319 3:61385962-61385984 ATAATACAGTAGCTATTCATAGG + Intergenic
955807251 3:62749937-62749959 TTAAAATAGAAACTCTTCATTGG - Intronic
955976635 3:64486338-64486360 TTCATTCAGTAACCATTTATTGG - Intergenic
955981177 3:64529163-64529185 TTAAAATAGCTACTATTTATTGG - Intronic
956009134 3:64812092-64812114 TGAATACAGTAAATATTGATAGG + Intergenic
956043938 3:65175194-65175216 TTATTCCAGAAAATATTTAATGG - Intergenic
956079301 3:65540622-65540644 TTTATTCAAAAACTATCTATTGG + Intronic
956853143 3:73250128-73250150 TTAATAAGGAAATTAATTATTGG - Intergenic
957003644 3:74917200-74917222 TTAAAAAAAATACTATTTATAGG + Intergenic
958049535 3:88327530-88327552 TTAATCAAGAAGTTATTTATTGG + Intergenic
958546186 3:95554299-95554321 TTAATAAAGAGATTCTTTATGGG + Intergenic
959431856 3:106263989-106264011 TTCATTCAGCAACTATATATTGG - Intergenic
959786754 3:110308458-110308480 TTAATACATAGACTATATCTCGG - Intergenic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
960692136 3:120357889-120357911 TTGATAAAGAGACAATTTATTGG + Intergenic
963043526 3:141086105-141086127 GTAATACAGAAAGAATTTAAGGG + Intronic
963254483 3:143131092-143131114 TGAATACAGAAGACATTTATTGG - Intergenic
963722942 3:148884924-148884946 TTAAGAAAAAAATTATTTATTGG + Intronic
963764347 3:149318437-149318459 TTAAAATAGAAAATATATATAGG - Intergenic
963910449 3:150812933-150812955 AAAATACAGAAGATATTTATTGG + Intergenic
964723401 3:159790248-159790270 CTTTTACAGAAACTTTTTATTGG + Intronic
965979849 3:174674564-174674586 ATAATACTGAAAATATTTGTTGG + Intronic
966075763 3:175935425-175935447 TTAATACAGAAAATTGTTACTGG + Intergenic
966572403 3:181460114-181460136 TTAAAATAAAAACTATCTATAGG + Intergenic
967222909 3:187263622-187263644 TTAATACAGAAACTATTTATTGG + Intronic
967258134 3:187613974-187613996 TAAACACAGACACTATTTACTGG + Intergenic
967450904 3:189621416-189621438 TATATACAGAGAATATTTATTGG - Intergenic
967649053 3:191963185-191963207 TTGATGCAGAAAGTTTTTATTGG + Intergenic
968398498 4:266474-266496 TTAAAACAGAGACTTTTTACAGG + Intergenic
970024930 4:11613561-11613583 TTAAAACACAAACTTTTTTTAGG - Intergenic
970226192 4:13859629-13859651 TTCATTCAAAAAATATTTATTGG - Intergenic
971196632 4:24476287-24476309 TTAATACAAAACTTATTTCTTGG - Intergenic
971251726 4:24978302-24978324 TTAATATAAAAATTATTAATAGG - Intronic
972207006 4:36785848-36785870 TTCATTCAGAAAATATTTAATGG + Intergenic
972209010 4:36814436-36814458 TTCATTCAGCAAATATTTATGGG - Intergenic
972999984 4:44935265-44935287 ATAATAAAGACATTATTTATGGG + Intergenic
973038252 4:45436371-45436393 TTAATTTAAAAAGTATTTATTGG - Intergenic
973184033 4:47302246-47302268 TTAATACAGCAACTAGAAATAGG - Intronic
973257182 4:48125334-48125356 CTCATTCAGCAACTATTTATTGG + Intronic
973658184 4:53073050-53073072 TCAGTACAGACACTATTTTTTGG - Intronic
973856183 4:55012542-55012564 TAAATACGGAAACTATGCATGGG - Intergenic
973894856 4:55401769-55401791 TTAATACTGAATTTATTTAGTGG + Intronic
974708569 4:65557444-65557466 TTGATTCAGCAAATATTTATAGG + Intronic
975325674 4:73056284-73056306 TTAATACAGAAAAAATTGACAGG - Exonic
975416007 4:74105323-74105345 ATAATACATAAATTATTTGTTGG + Intergenic
975482424 4:74895871-74895893 AAAATTCAGCAACTATTTATTGG + Intergenic
975544869 4:75550118-75550140 TTCATTCAACAACTATTTATTGG - Intronic
975644619 4:76534064-76534086 TTCATACATAATCTCTTTATTGG - Intronic
975646414 4:76550411-76550433 TTAAGACAGAAACCATTAAGAGG + Intronic
975787451 4:77907426-77907448 TAAAAACTGAAACAATTTATTGG - Intronic
976034948 4:80806471-80806493 TTCATTCAGCAAATATTTATTGG + Intronic
976133765 4:81912727-81912749 TTAATGCAACAATTATTTATTGG - Intronic
976508455 4:85879131-85879153 TTAATCCAGAAAGTGTTTTTTGG + Intronic
976528871 4:86126982-86127004 TTAATGCAGAGACTATATAAGGG - Intronic
976815462 4:89143027-89143049 TTAATTCAGAAAGCATTTGTAGG + Intergenic
977453164 4:97224569-97224591 TGAAAACAGAAACTATTTTCAGG + Intronic
977631990 4:99253157-99253179 TTACTATAGAATCTATGTATAGG + Intergenic
977650009 4:99458644-99458666 TAAATGCAGAAACTTTTTCTTGG + Intergenic
977783322 4:101004956-101004978 TTAATACAGAAAATTGGTATTGG + Intergenic
977998380 4:103524469-103524491 TTAAGTCAGAATTTATTTATGGG + Intergenic
978049282 4:104175861-104175883 TTAAGGTAGAAACTATTTTTAGG - Intergenic
978531386 4:109717843-109717865 ATAACACAGAAAATATTTGTAGG - Intronic
980226056 4:129987380-129987402 TTATTACACAAACTATTTTCAGG + Intergenic
980576730 4:134692511-134692533 TTAATATAGTGATTATTTATTGG + Intergenic
981589408 4:146341821-146341843 TTAATACAGAAAATATTATAAGG + Intronic
981680040 4:147387137-147387159 TGTATACAGCAGCTATTTATAGG + Intergenic
981761227 4:148197390-148197412 TTAATTCAATAAGTATTTATGGG + Intronic
982095662 4:151920201-151920223 TTAAGACAAAAATAATTTATAGG + Intergenic
982235254 4:153246218-153246240 TTAAAAGAGATACTTTTTATAGG - Intronic
982470920 4:155789037-155789059 CAAAAACAGAAAATATTTATTGG + Intronic
982671841 4:158329924-158329946 TTAAGGCAGAAAATAATTATTGG + Intronic
982857381 4:160401431-160401453 TAAAAAAAGAAAATATTTATGGG - Intergenic
983353865 4:166630576-166630598 TATATACAGAAACTAATCATAGG + Intergenic
983526353 4:168764002-168764024 TTACTGCAGTAAATATTTATAGG - Intronic
983856507 4:172652907-172652929 CTAAAACAGAAAGAATTTATGGG - Intronic
984549589 4:181144738-181144760 TTATTTCAGAAAAGATTTATTGG + Intergenic
986223635 5:5792990-5793012 TTAATTCAACAAATATTTATTGG - Intergenic
986278342 5:6301696-6301718 TTCATTCAGCAAATATTTATTGG + Intergenic
986653104 5:9984102-9984124 TTATTACAGAAACGATTGGTAGG - Intergenic
987067111 5:14300846-14300868 TTAATTCTAAAAATATTTATGGG - Intronic
987391737 5:17382753-17382775 TCATGACAGAAACTATTTATTGG + Intergenic
987508069 5:18798836-18798858 CTAATAATGATACTATTTATAGG + Intergenic
987649919 5:20727660-20727682 AAAATCCAGAAACTTTTTATTGG - Intergenic
987795005 5:22616510-22616532 TAAATGTAGAAACTATATATAGG - Intronic
988058105 5:26126972-26126994 ATTATACAGAGAATATTTATGGG - Intergenic
988071359 5:26292433-26292455 TTAATATTGTAATTATTTATTGG - Intergenic
988237708 5:28567266-28567288 GTAATGCAGAAAATATTCATTGG - Intergenic
988263342 5:28919766-28919788 TTACTACAGAAATTATATCTAGG + Intergenic
988362960 5:30259351-30259373 ATAAAACTGAAAGTATTTATAGG - Intergenic
988422689 5:31025486-31025508 TTTATAGAGAATCTATTTTTAGG + Intergenic
988660311 5:33259325-33259347 TTCATTCAGCAAATATTTATTGG + Intergenic
988745641 5:34133841-34133863 AAAATCCAGAAACTTTTTATTGG + Intergenic
989009592 5:36855268-36855290 TAAATGCAGATTCTATTTATAGG - Intergenic
989011102 5:36874711-36874733 TTCATTCAGCAAGTATTTATTGG - Intergenic
989477108 5:41886819-41886841 CTAATTCAAAAACTATTTAAAGG - Intergenic
989577801 5:43005149-43005171 TTAATAAGGAAACTTATTATGGG + Intergenic
989612870 5:43312553-43312575 TTAATCCAAAACCTATTTGTGGG + Intronic
990025606 5:51183803-51183825 TTTATTCAGAAAATATTTATTGG + Intergenic
990137468 5:52664020-52664042 TAAATCCAAAAACTATGTATAGG - Intergenic
990238344 5:53791795-53791817 TGAATACGGAATCTATTTCTAGG - Intergenic
991362400 5:65834133-65834155 TTAAGACAGAAACAATTCACTGG - Intronic
991586394 5:68206453-68206475 TTAATTCAGAAAGTATTTATTGG + Intergenic
992144111 5:73827992-73828014 TAAAAAAAGAAACTATTTTTGGG + Intronic
992712798 5:79477259-79477281 ATAATCCGGAAACTATTTATTGG + Intronic
993301016 5:86210205-86210227 TTAAGATAAATACTATTTATAGG - Intergenic
993345018 5:86772084-86772106 TTAAGATAGAAACTATATAGAGG + Intergenic
993553047 5:89299270-89299292 TTAATAGAGATACTTTTTATAGG - Intergenic
993639695 5:90387416-90387438 TTAATTCACATACTCTTTATTGG - Intergenic
993911339 5:93688717-93688739 TTAACAGAGAAAATATTTTTAGG - Intronic
994726901 5:103446763-103446785 TTAATGCACAAAATATTTATTGG - Intergenic
994798515 5:104338730-104338752 TTAATATAGCAATTATTTATTGG + Intergenic
995109405 5:108412230-108412252 TTAAAAAAAAAACTATTTAAAGG + Intergenic
996014630 5:118519474-118519496 TTATTAAAGAGACAATTTATTGG + Intergenic
996236132 5:121132290-121132312 TTAATAGAGAAGTTATTAATAGG + Intergenic
996331400 5:122333338-122333360 TTATTACGGAACCTATTTGTTGG + Intronic
996813925 5:127552767-127552789 TTAATACAGAAATTTTTGAGAGG + Intronic
997815522 5:137013679-137013701 TAAATTCTGAAAGTATTTATGGG - Intronic
998268465 5:140684730-140684752 CTAATACAGTAAATATTGATAGG - Intronic
998280102 5:140797645-140797667 TTAAGAGAGAAAATATTTATGGG - Intronic
998408249 5:141886991-141887013 TTAAGTCATAAAATATTTATTGG + Intergenic
998538136 5:142953237-142953259 TTAATTCAGTGAATATTTATTGG + Intronic
998860482 5:146438736-146438758 TTAAAACAGAAACTATTTTCAGG + Intergenic
998868767 5:146532064-146532086 TTAATACATAAAATATTTTTGGG + Intergenic
998987110 5:147771831-147771853 TCAAAATAGAAAATATTTATAGG - Intronic
999962775 5:156775132-156775154 TTATTACAGTCACAATTTATAGG - Intergenic
1003152229 6:3562741-3562763 TTAAAACATAATGTATTTATAGG + Intergenic
1003300465 6:4876713-4876735 TTATTCTAGAAACTTTTTATAGG + Intronic
1003366109 6:5476516-5476538 TTCATCCAATAACTATTTATTGG - Intronic
1003707478 6:8550004-8550026 TTCATTCAGCAACAATTTATTGG + Intergenic
1004979072 6:21002403-21002425 TTGAAACTGAAACTATATATGGG - Intronic
1005543802 6:26842075-26842097 AAAATCCAGAAACTTTTTATTGG + Intergenic
1008464919 6:51819699-51819721 TTTATTCAGCAACTATTTACTGG - Intronic
1008674106 6:53801081-53801103 TTATTACAGAAATGATTTGTTGG + Intronic
1008866465 6:56216959-56216981 TTAATACAGAAAATACTTGTAGG - Intronic
1009014583 6:57883741-57883763 AAAATCCAGAAACTTTTTATTGG + Intergenic
1009410704 6:63362218-63362240 TTAATACAGAAACCAGTAAGAGG + Intergenic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1009730818 6:67603628-67603650 TTAATTCTGTAAATATTTATTGG - Intergenic
1009759266 6:67982062-67982084 TTAATTCAGTAACTAATTAATGG + Intergenic
1010115708 6:72307387-72307409 TTAAAAGGGAAACTATTTGTTGG - Intronic
1010929276 6:81780767-81780789 TTCATACAGCAACTATTGAATGG - Intergenic
1011575547 6:88793914-88793936 TTAAAACATAAATTATTTTTAGG + Intronic
1011579582 6:88844977-88844999 TTAATATACTTACTATTTATAGG + Intronic
1011662963 6:89609907-89609929 TTTACACAGAAACAATTTCTGGG - Intronic
1012218866 6:96623567-96623589 TTAATTCAGAAAGTATTTATTGG - Intergenic
1012334887 6:98043278-98043300 TTAATACAAAGAGTAATTATAGG - Intergenic
1012425595 6:99110819-99110841 TCAGTTCAGAAAGTATTTATTGG - Intergenic
1014192031 6:118507205-118507227 TTCATACAGCAACAATTGATTGG - Intronic
1015095006 6:129405297-129405319 TTACTACAGCAAATTTTTATTGG - Intronic
1015445596 6:133300457-133300479 TTAATACAGAGACTAAATACTGG - Intronic
1015915985 6:138217096-138217118 ATAATGCATAAACTATTTAAAGG - Exonic
1016134470 6:140522534-140522556 TTAATACAAAAAATAATTTTAGG + Intergenic
1016850559 6:148614403-148614425 TTAATAAAGAGATTATTTAGAGG - Intergenic
1018538152 6:164846038-164846060 TTAATACAGAAACAGGTTATGGG + Intergenic
1020392515 7:7673832-7673854 TTCATTCAGCAAATATTTATTGG - Intronic
1021003690 7:15366627-15366649 CTAATATAGAAAATATTTAAAGG + Intronic
1021185312 7:17557225-17557247 TTTAAACAAAAACTGTTTATTGG + Intergenic
1021372923 7:19872562-19872584 TTAATACACATAATATGTATGGG - Intergenic
1021410698 7:20327333-20327355 TTAATACAGAGACTCCTTAAAGG - Intergenic
1021794164 7:24236719-24236741 TTAGAACAGAAATTATTTTTGGG + Intergenic
1021822614 7:24513163-24513185 TTTAAACAGAATCTATTTAAGGG - Intergenic
1022056048 7:26735425-26735447 TAAATACAGACAATATTTATTGG + Intronic
1022400365 7:30030352-30030374 TTGATACAGTAACTATTTCCTGG + Intronic
1024413611 7:49077612-49077634 TTAATACTGATATTGTTTATGGG - Intergenic
1024429896 7:49275576-49275598 TAAATTCAGAAACTATTCCTTGG - Intergenic
1024487930 7:49941134-49941156 AAAAAACAGAAAATATTTATTGG + Intronic
1024734065 7:52284615-52284637 TTAATACAAATACTGGTTATTGG + Intergenic
1027662486 7:81004001-81004023 TTAAAACAACAACTATTTTTTGG + Intergenic
1027850350 7:83443828-83443850 TTAATGCAACAACTATTTAAGGG + Intronic
1027939658 7:84659129-84659151 ATTATACTGAAAATATTTATTGG - Intergenic
1027994038 7:85400772-85400794 TTAATAAAAAAACTCTTTTTAGG - Intergenic
1028085272 7:86628652-86628674 TTAAGACAGAATATAGTTATTGG + Intergenic
1028654310 7:93185751-93185773 TTAATAAAGACACCATCTATAGG - Intergenic
1028947395 7:96596013-96596035 TTCATGCAGAAACTGTTCATAGG + Intronic
1029141062 7:98410654-98410676 TAAAAAAAGAAAATATTTATTGG - Intergenic
1029331593 7:99860829-99860851 TTTATCCCCAAACTATTTATAGG + Intronic
1029815778 7:103093151-103093173 TTACTTAAGAAACTTTTTATAGG - Intronic
1029924936 7:104305281-104305303 TTAATACCTAATCTATTCATTGG - Intergenic
1030468459 7:109932716-109932738 GCATTACAAAAACTATTTATGGG + Intergenic
1030546943 7:110907653-110907675 TAAATCTAGAAACTATTGATAGG - Intronic
1030592445 7:111499020-111499042 TTAAAACAAAAATCATTTATTGG + Intronic
1030771666 7:113483315-113483337 ATAATAGAGAAAATATTTAAAGG + Intergenic
1031002089 7:116427495-116427517 TTAAGACAGAGACTATATATAGG + Intronic
1031021814 7:116637024-116637046 TTAATGCTGAAAATATCTATTGG + Intergenic
1031081929 7:117266462-117266484 TCAATCCAGAAAGTATTTAAAGG + Intergenic
1031537123 7:122948313-122948335 TAAATATGGAAAATATTTATTGG + Intergenic
1031611180 7:123829510-123829532 TTGATACAGCAATTATTTACTGG + Intronic
1031744660 7:125478928-125478950 TTAATACATAAACTATTTATGGG - Intergenic
1033230594 7:139594385-139594407 TTAACACAGTCAGTATTTATTGG - Intronic
1033242965 7:139695938-139695960 TTAATTCAGGAAACATTTATTGG - Intronic
1033706797 7:143896239-143896261 TTAAAACAGAAAACATTAATAGG + Intronic
1033755278 7:144393924-144393946 TTAATAGAGACACCATTTGTAGG + Intergenic
1033864613 7:145673466-145673488 TTAATATAAAAAATATTAATTGG - Intergenic
1038550487 8:28464157-28464179 ATAATGCAGAAACTATTTGGGGG - Intronic
1039267004 8:35836515-35836537 TTAAGACAGAAACCATGGATTGG + Intergenic
1039399580 8:37257910-37257932 TTCATTCAACAACTATTTATTGG - Intergenic
1040824920 8:51610500-51610522 TTAATAGAGAAACTATTTTAGGG + Intronic
1041003475 8:53475954-53475976 AGAATTCAGAAACTATTCATGGG + Intergenic
1041165016 8:55083008-55083030 TTAGTATATAACCTATTTATAGG + Intergenic
1041426463 8:57726344-57726366 TTAATAGAGAAAATAGTTATGGG + Intergenic
1041478586 8:58293275-58293297 TTTATGCAGAAACTGATTATTGG - Intergenic
1041583304 8:59487263-59487285 TTAATTCAGAAACTCTGTCTAGG + Intergenic
1041653509 8:60325101-60325123 TTATTACAGAAAAAATTTAAGGG - Intergenic
1042949547 8:74186736-74186758 TTGATACAGAAATTAATAATGGG + Intergenic
1043312766 8:78882163-78882185 TTTATACAGAAACAAATAATTGG - Intergenic
1044089061 8:87976931-87976953 TTAATCCAGCATATATTTATTGG + Intergenic
1044299392 8:90566253-90566275 TTTATACAGAAACCATTTGAAGG - Intergenic
1044552833 8:93531446-93531468 TATAGACAGAAGCTATTTATGGG + Intergenic
1045918431 8:107501273-107501295 TTAACACAGAGAGCATTTATTGG - Intergenic
1046054225 8:109060146-109060168 TTAATTCAACAAATATTTATTGG - Intergenic
1046164876 8:110419425-110419447 GAAATACAGACACTATTTAATGG - Intergenic
1046196127 8:110865218-110865240 TTAAAATAAAAATTATTTATGGG - Intergenic
1046240242 8:111480523-111480545 TTAATAATTAATCTATTTATAGG - Intergenic
1046303530 8:112330454-112330476 TTAATACCGAAATTATTTTATGG - Intronic
1046314615 8:112483037-112483059 CTAATACAGCATATATTTATTGG - Intronic
1046621604 8:116534444-116534466 TAAAAAAAAAAACTATTTATTGG + Intergenic
1046852450 8:118990429-118990451 TTAAGACAGAATCTATTTAGTGG - Intergenic
1046991674 8:120464429-120464451 TTAATGCACAAAATCTTTATTGG + Intronic
1048127073 8:131647695-131647717 TTAATTGAGAATCTCTTTATTGG + Intergenic
1048293263 8:133196364-133196386 TTAATATAAAAATTATTAATGGG - Intronic
1048345878 8:133573830-133573852 TTCATCCAAAAACTCTTTATTGG - Intergenic
1050103027 9:2138219-2138241 TTAAGACAAAAAGTATTAATTGG + Intronic
1050228326 9:3487460-3487482 TTAAGTCAGAAACTATTAGTTGG + Intronic
1050260939 9:3840435-3840457 TTAATACAGAGTCTATAAATGGG + Intronic
1050710154 9:8452341-8452363 CTAACACAGAAACCATTTCTAGG + Intronic
1050720079 9:8578365-8578387 TTAATAAATAGACTATATATAGG - Intronic
1051165505 9:14257950-14257972 TTTAAACAAAATCTATTTATAGG - Intronic
1051778665 9:20664362-20664384 TTAATACTGATTCTATTTAATGG + Intronic
1051816664 9:21116283-21116305 TTAAAACAAAAAGTATTGATTGG + Intergenic
1052157147 9:25206157-25206179 GTGATAAAGAAACTGTTTATTGG + Intergenic
1052278406 9:26704789-26704811 GTAATACAGAAGCTATTTATAGG - Intergenic
1052361018 9:27557708-27557730 TAAATATAGAAACTAGTTAAAGG - Intronic
1052913876 9:33908954-33908976 GGAATACAGAGGCTATTTATAGG - Intronic
1053103987 9:35394879-35394901 TTAATACAGAAATTAGGGATAGG + Intronic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055256597 9:74379092-74379114 TTATTTCAGAAAGTATTTAGAGG + Intergenic
1055595109 9:77857823-77857845 TTAATGAAAAAACAATTTATAGG + Intronic
1055634288 9:78259973-78259995 TTTATTCAGCAATTATTTATTGG + Intronic
1055705956 9:79004460-79004482 TTAATAAAGACACTATCTAGTGG - Intergenic
1055829552 9:80361396-80361418 TTAATACTGGAACAATGTATTGG + Intergenic
1056046191 9:82719651-82719673 TTAATTCAACAAATATTTATTGG + Intergenic
1056311390 9:85345001-85345023 TTGACACAGAGACTATTTTTGGG - Intergenic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1059096842 9:111425996-111426018 TTACTCCACAGACTATTTATAGG - Intronic
1059598167 9:115745661-115745683 TTGGTACAGAACCTTTTTATAGG + Intergenic
1059724602 9:116993568-116993590 TTACTATAGATACTATATATAGG + Intronic
1059921542 9:119166101-119166123 TTAATATAGAAAGAATTTCTGGG + Intronic
1060056423 9:120417827-120417849 TTAATACAGATTCTATAAATTGG - Intronic
1060271483 9:122145553-122145575 TAAATTCAGAAACCTTTTATTGG + Intronic
1060432925 9:123565861-123565883 TTCTTACAGAAACTATTCCTGGG - Intronic
1060705868 9:125800474-125800496 ATAATAGAAAAACTCTTTATTGG - Intronic
1061649764 9:132038136-132038158 TTCATTCAGCAAATATTTATGGG + Intronic
1186669524 X:11755899-11755921 TTCATTCAGCAAATATTTATTGG - Intergenic
1186800467 X:13087613-13087635 TTTATACATAATCGATTTATGGG - Intergenic
1186873650 X:13796383-13796405 CTAATATAGAAAATATTTATAGG + Intronic
1186991922 X:15079389-15079411 TCAATACTAAAACAATTTATTGG - Intergenic
1187355672 X:18568584-18568606 TTACTATAGAAGCTATTCATTGG - Intronic
1188010811 X:25054041-25054063 TTAAAAGAGAAAACATTTATTGG + Intergenic
1188062156 X:25614505-25614527 TTCATACTGCAAATATTTATCGG + Intergenic
1188657154 X:32712145-32712167 TTTATTCTGTAACTATTTATTGG + Intronic
1188853571 X:35163014-35163036 TAAAAATAGAAACTATTTTTTGG + Intergenic
1188944073 X:36276204-36276226 TTAATATACAAGTTATTTATAGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189649626 X:43175497-43175519 CGAAGACTGAAACTATTTATTGG + Intergenic
1189977037 X:46472122-46472144 CTAATGCAGGAACAATTTATAGG + Intronic
1190490347 X:50976314-50976336 TATATACATAAACTATATATTGG - Intergenic
1191017304 X:55822952-55822974 TTAATAAAGAACCAATTTTTGGG + Intergenic
1192625105 X:72719038-72719060 TTAATAGACAAACCACTTATGGG - Intergenic
1192819452 X:74628968-74628990 TTAATACAGTATATATTTCTGGG + Intergenic
1194470729 X:94292276-94292298 TAAATACAGAACCTATTTCTGGG - Intergenic
1194598174 X:95885761-95885783 TTAATGCAGTACCTATTTAAAGG + Intergenic
1194600712 X:95918412-95918434 ATAATACAAAAAATATATATAGG + Intergenic
1195453265 X:105039479-105039501 TTGACCCAGAACCTATTTATAGG - Intronic
1196076910 X:111587636-111587658 TAAATAAAGAAACTACATATGGG - Intergenic
1197292855 X:124681479-124681501 TTAATGCAGTAATTATTTGTTGG + Intronic
1197405620 X:126044708-126044730 TAAATGAAGAAAATATTTATGGG - Intergenic
1197419824 X:126225072-126225094 AAAATACAGAAGTTATTTATTGG + Intergenic
1197454607 X:126663184-126663206 TTTATTCAGAAAATATTAATTGG - Intergenic
1197812745 X:130462241-130462263 TTTTTACAGAAACCATTTGTTGG + Intergenic
1197996479 X:132381319-132381341 TTAATATAAATAATATTTATAGG - Intronic
1198404899 X:136302594-136302616 TTAAAACAGAAACTTTTTGAGGG + Intronic
1199191179 X:144972957-144972979 TTAATTCAACAAATATTTATTGG - Intergenic
1199791591 X:151160609-151160631 TGAATACAGAAAATAATAATTGG - Intergenic
1200352389 X:155511777-155511799 CTAACAGAGAAACCATTTATGGG - Exonic