ID: 967223088

View in Genome Browser
Species Human (GRCh38)
Location 3:187265647-187265669
Sequence TGACCTCTGTTTCCTATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967223088_967223093 7 Left 967223088 3:187265647-187265669 CCTTCTATAGGAAACAGAGGTCA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 967223093 3:187265677-187265699 GGAAGTGACTTGCTCAAGGCTGG 0: 1
1: 3
2: 8
3: 25
4: 227
967223088_967223092 3 Left 967223088 3:187265647-187265669 CCTTCTATAGGAAACAGAGGTCA 0: 1
1: 0
2: 2
3: 16
4: 226
Right 967223092 3:187265673-187265695 GAGGGGAAGTGACTTGCTCAAGG 0: 3
1: 41
2: 288
3: 1174
4: 3736

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967223088 Original CRISPR TGACCTCTGTTTCCTATAGA AGG (reversed) Intronic
902631483 1:17707127-17707149 TGACCTCCGTTTCCTCTGTAAGG - Intergenic
903394150 1:22986455-22986477 TGAACTCTGTGTCCTCTGGAAGG - Intergenic
903881412 1:26512408-26512430 TGGCATCTTCTTCCTATAGAAGG - Intergenic
904734663 1:32621936-32621958 TGACTTCTGTTCCCTAAAGTTGG + Exonic
905342232 1:37287187-37287209 TGACTTCTCTTGCATATAGATGG + Intergenic
906255148 1:44343033-44343055 GGACCTCTGTTTCTTTTAGTGGG - Intronic
906558792 1:46738111-46738133 TGACATCTTCTTCCAATAGAAGG + Intergenic
907802568 1:57784889-57784911 TGGCATCTTCTTCCTATAGAAGG - Intronic
909597587 1:77423359-77423381 TGGCCTCTGTCAGCTATAGAAGG - Intronic
909916055 1:81320961-81320983 TGGCATCTGTTTCCAATATAAGG + Intronic
910633680 1:89383642-89383664 AGACCTCTTTTGCCTATGGAAGG - Exonic
910742643 1:90536769-90536791 TGATCCCTGTTTGTTATAGAGGG - Intergenic
915786141 1:158614336-158614358 TAACCTGTGTTTCATATACAGGG - Intronic
916191524 1:162183506-162183528 TGGCCTCTTCTTCCAATAGATGG + Intronic
917115414 1:171598396-171598418 TGGCATCTGCTTCCAATAGAAGG - Intergenic
917736254 1:177923152-177923174 TCACCTCTGTATCCCATAGAAGG + Intergenic
922179451 1:223222655-223222677 AGGTCTCTGTTTCCTACAGAAGG - Intronic
922285299 1:224165765-224165787 TGAACCCTGTCTCCTATTGATGG - Intergenic
922389502 1:225125326-225125348 TGGCCTCTTCTTCCAATAGAAGG + Intronic
922763720 1:228147211-228147233 TGGCCTCTGTTCCCTGTAGGCGG + Intronic
1063447125 10:6126355-6126377 AGAAATTTGTTTCCTATAGAAGG - Intergenic
1063881251 10:10535311-10535333 TGCCCTCTGGTTCCCATAGCAGG + Intergenic
1064527778 10:16275908-16275930 TGTCCACTGTTTGCTCTAGAGGG + Intergenic
1064950006 10:20837645-20837667 TGGCATCTTTTTCCAATAGAAGG - Intronic
1067548232 10:47212157-47212179 TGACGTCTTCTTCCAATAGAAGG - Intergenic
1070519755 10:77242137-77242159 TGACCTCAGTTTCAAAAAGATGG + Intronic
1071222104 10:83479690-83479712 TGACATCTTCTTCCCATAGAAGG - Intergenic
1072889694 10:99312261-99312283 TGACATCTGGTTCCAAGAGAAGG - Intergenic
1073625963 10:105097217-105097239 GGAAGTCTGTCTCCTATAGAGGG - Intronic
1074468137 10:113702592-113702614 TGGCATCTTCTTCCTATAGAAGG - Intronic
1075168276 10:120089181-120089203 TGACATCTTCTTCCAATAGAAGG - Intergenic
1076204220 10:128582192-128582214 TGACATCTGTTTCCTGAAGGTGG + Intergenic
1076501191 10:130937576-130937598 AGACCCCTGTTTCCTAATGAAGG + Intergenic
1083752617 11:64769129-64769151 TGACCTCTTTTTCCTTTAATAGG - Exonic
1084701292 11:70787799-70787821 TGACATCTGTTTCCTTTACCTGG - Intronic
1085530016 11:77186383-77186405 TGACATCTTCTTCCAATAGAAGG + Intronic
1085724883 11:78946101-78946123 TGACATCTTCTTCCAATAGAAGG - Intronic
1087065960 11:94028337-94028359 TGACCTCTGCATCTTTTAGAGGG - Intronic
1087735982 11:101834475-101834497 TGACATCTTCTTCCAATAGAAGG - Intronic
1089794723 11:120970966-120970988 TTACCTCTGTTTTCCAGAGACGG - Intronic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1092966105 12:13644620-13644642 TGGCATCTTTTTCCAATAGAAGG + Intronic
1093124961 12:15316953-15316975 TCACCTCTGTTTCCTCTCTAAGG + Intronic
1096137362 12:49213691-49213713 TGAACTCTGGTCCCTATAAAAGG - Intronic
1097372179 12:58797815-58797837 TTACCACTGTGTCCTTTAGAAGG - Intronic
1097918688 12:65047726-65047748 TGATGTCTGTTTCCTGTATATGG + Intergenic
1098700955 12:73625180-73625202 TGATCTCCATTTCCTAGAGAAGG - Intergenic
1100255601 12:92879970-92879992 TGCCTTCTGGTTCCTAAAGAAGG - Intronic
1101685142 12:107011847-107011869 TGACATCTTCTTCCAATAGAAGG - Intronic
1106099171 13:26679577-26679599 AGAACTCTGTTTCCTTTAAAAGG + Intronic
1106579385 13:31004387-31004409 TTGCCTCTGTTTCCTCAAGACGG + Intergenic
1106625987 13:31421515-31421537 TGACCTTTGTTTCCAGTGGAGGG + Intergenic
1108499069 13:51052337-51052359 TGACCTCTGATTCACTTAGAAGG + Intergenic
1110713428 13:78674771-78674793 TAACCACTATTTCCTAGAGATGG - Intergenic
1110757472 13:79192558-79192580 TGACCTCATTTTCCTACATAGGG + Intergenic
1111278416 13:85984520-85984542 TGACATCTTCTTCCAATAGAAGG + Intergenic
1111384389 13:87505031-87505053 TGGCATCTTCTTCCTATAGAAGG + Intergenic
1111487070 13:88917674-88917696 TGACATCTTCTTCCAATAGAAGG + Intergenic
1115136359 14:30113406-30113428 TGACATCTTCTTCCAATAGAAGG - Intronic
1115151336 14:30289530-30289552 TGACATCTGTTACCTGTTGATGG + Intergenic
1116193791 14:41695422-41695444 TGGCCTCTTTTTCCAATAGAAGG - Intronic
1116544946 14:46153462-46153484 TGACATCTGTATCCTATATCAGG + Intergenic
1117059843 14:51950822-51950844 TGACCACTCTTTCCTAGAGAGGG + Intronic
1117750706 14:58920448-58920470 TGTCCTATGTTTCATGTAGAAGG - Intergenic
1118391636 14:65300623-65300645 GGATCTGTGTTTCCTCTAGAAGG + Intergenic
1118840066 14:69503203-69503225 TGCCCTCTGTTATCCATAGAGGG + Intronic
1121841689 14:97139673-97139695 TGAGTTCTTTTTCCTAGAGAAGG - Intergenic
1125109201 15:36011076-36011098 TGACGTCTTCTTCCAATAGAAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1127628072 15:60799963-60799985 CTGGCTCTGTTTCCTATAGAGGG + Intronic
1128324185 15:66713035-66713057 GGATCTCTGTTTCCTCTAGTGGG + Intronic
1128950480 15:71875476-71875498 TAACCCCTGTTTTCTTTAGAAGG + Intronic
1129766673 15:78173942-78173964 TGAGCTCTGTTTCAAAGAGACGG + Intronic
1131655399 15:94452150-94452172 GGACTTCAGTTTCCTATACATGG + Intronic
1131769986 15:95726973-95726995 TGACCCCTGGTTCCCACAGAGGG - Intergenic
1131910349 15:97192713-97192735 TCAGCTATGTTTCCTATAGTTGG + Intergenic
1132084616 15:98897458-98897480 TGACCTTTATTTGCAATAGATGG + Intronic
1133456656 16:5948164-5948186 TAGCCTCTGTTTGCTATAGAGGG + Intergenic
1141406281 16:83796436-83796458 TGACTTCTACTTCCTACAGAAGG - Intronic
1143855899 17:9848706-9848728 TTACCTGTGTTTCTAATAGAGGG + Intronic
1144402411 17:14919006-14919028 TGACCTCTAGTTCCTACAGATGG + Intergenic
1149018474 17:51935922-51935944 TGACTTCTTTGTCCTAGAGAAGG + Intronic
1150234673 17:63583440-63583462 TTACCTCTTCTTCCTATAGGAGG - Intronic
1150948035 17:69768494-69768516 TGACATCTTCTTCCAATAGAAGG - Intergenic
1151435651 17:74095216-74095238 TGACCACTGTGTCATGTAGATGG - Intergenic
1152290770 17:79438769-79438791 TCACCTGCGTTTCCTCTAGAAGG + Intronic
1153739009 18:8103298-8103320 TGGCATCTGCTTCCAATAGAAGG + Intronic
1155406483 18:25493719-25493741 TGACATATTTTTCCAATAGAAGG - Intergenic
1157420396 18:47543060-47543082 TGACATCTGATTCTTATAGAAGG - Intergenic
1157719168 18:49910281-49910303 AGACCTCTGATTCCCAAAGAGGG - Intronic
1158582204 18:58693506-58693528 TGACATCTTCTTCCAATAGAAGG - Intronic
1159630600 18:70745429-70745451 TGAAATCTGATACCTATAGAAGG - Intergenic
1160459901 18:79031083-79031105 TGACTTGTGTTTCCTTCAGAAGG - Intergenic
1161248779 19:3269613-3269635 TGACCTGTGTATGCTAGAGATGG - Intronic
1164608043 19:29613914-29613936 TGTGCTTTGTTTCCTGTAGAAGG - Exonic
1164940304 19:32247251-32247273 TGACATCTTCTTCCAATAGAAGG - Intergenic
1167064868 19:47177615-47177637 TCACCTCAGTTTCCCAAAGAGGG + Intronic
926223200 2:10949576-10949598 TGATCTCTGCTTCTAATAGAAGG - Intergenic
927531721 2:23811382-23811404 TGACCGCTGCTTCCTCTGGAGGG - Intronic
929432035 2:41895352-41895374 TGACCTCATTTCCATATAGAGGG - Intergenic
929657753 2:43751064-43751086 TGACCTCCGTTTCACATACAGGG - Intronic
933465914 2:82651347-82651369 TGACTTCTTTTTCCAATAAAAGG + Intergenic
934753457 2:96809371-96809393 AGCCCTCAGTTTCCCATAGACGG + Exonic
934762730 2:96865317-96865339 TGACCTCTGTCTCCCATAGATGG - Exonic
934992095 2:98929123-98929145 TGACCTTTGTTCCCTAAGGAGGG - Intronic
936238371 2:110766443-110766465 TGACCTCAGTTGCCTTCAGATGG + Intronic
939448842 2:142345851-142345873 TGTCCTCTGTTTTCTGTTGATGG - Intergenic
941392130 2:164927177-164927199 TGAACTCTGCTTCCTCTGGAGGG - Intronic
941644888 2:168029776-168029798 TTACTTCTGCTTCCTACAGATGG - Intronic
942281536 2:174369076-174369098 TGGCATCTTTTTCCAATAGAAGG + Intronic
942982644 2:182100766-182100788 TGACCGCTGTTTCCTACTTAAGG - Intronic
943320396 2:186436711-186436733 TGACCAATGTTTCCAACAGATGG + Intergenic
944212174 2:197217957-197217979 TTCCCTCTGCTTCCTATTGATGG + Intronic
944541028 2:200753784-200753806 TGATCTCTGTTTCCTAGATGAGG - Intergenic
944798405 2:203210970-203210992 TTACATCTGTTTTCTATAAATGG + Exonic
945922731 2:215772154-215772176 TGGCCTCTGTTTCCCATGCAAGG - Intergenic
946539659 2:220670263-220670285 TTACTACTGTTTCATATAGATGG + Intergenic
1170366064 20:15599455-15599477 TGACCACTGTTTCGTGTAAAGGG - Intronic
1170498112 20:16946793-16946815 TGGCCTCGGTTCCCTTTAGAAGG + Intergenic
1170898823 20:20440342-20440364 TGACCACTGTTTCTTAGAGCAGG - Intronic
1172434586 20:34920120-34920142 TGGCCTCTCTTTCATAGAGATGG + Intronic
1173313317 20:41920227-41920249 TGACATCTTCTTCCAATAGAAGG + Intergenic
1174541392 20:51292506-51292528 TAACTTCTGTTTCCTATTGATGG - Intergenic
1175250442 20:57606525-57606547 TGACATCTTTTTTCAATAGAAGG - Intronic
1175547074 20:59785286-59785308 TGGCCTCTGTTTCCTCTACAGGG + Intronic
1175904400 20:62372405-62372427 TGAGCTCTGGTTCTCATAGAGGG + Intergenic
1182541530 22:31045525-31045547 TAGACTCTGTTCCCTATAGATGG + Intergenic
1183053813 22:35288389-35288411 TCACCTCAGTTTCCTGCAGACGG - Exonic
1183932205 22:41241717-41241739 TGACCCCTGTTTCCAATTAAAGG - Intergenic
950829072 3:15857036-15857058 TGACCTGCTTTTCCTGTAGACGG + Intronic
954182911 3:48895676-48895698 TCACCTCTGTTGCCCAGAGAGGG - Intronic
955664081 3:61331957-61331979 TGAGCTCTATTTCTTATAAAGGG + Intergenic
958022180 3:88011164-88011186 TGACCACTGGTTCCTATGGGAGG + Intergenic
959109736 3:102107970-102107992 TGACATCTTCTTCCAATAGAAGG + Intronic
959971747 3:112417210-112417232 TGACCAGTAGTTCCTATAGATGG - Intergenic
961852496 3:129835229-129835251 TGACCACTGTTTCCTATTCATGG + Intronic
961975176 3:131016771-131016793 TGACCTCTGTGTTTTATAGGAGG + Intronic
962157383 3:132962284-132962306 TGACATCTTCTTCCAATAGAAGG + Intergenic
962167870 3:133069093-133069115 TGACCTCTTTTCCCTAAAGATGG + Intronic
962189054 3:133291096-133291118 TGACCTCTGTATGTTATACATGG - Intronic
962949959 3:140209250-140209272 TGAGCTCTCTTTTCTATTGAAGG - Intronic
963081324 3:141397072-141397094 TGACATCTCCTTCCAATAGAAGG + Intronic
967223088 3:187265647-187265669 TGACCTCTGTTTCCTATAGAAGG - Intronic
967399791 3:189048566-189048588 TGGCATCTTTTTCCAATAGAAGG + Intronic
969148127 4:5142003-5142025 TGACCACTGCTTCCTACTGAGGG + Intronic
971229542 4:24789895-24789917 TTCCCTCTGTTTTCTCTAGAAGG + Intronic
974254708 4:59434182-59434204 TGAACTCTGTTTCCCTGAGATGG + Intergenic
974623155 4:64386043-64386065 TGACATTTGCTTCCTATACAAGG - Intronic
974728491 4:65828898-65828920 GGACTTCTGATTCTTATAGAAGG - Intergenic
976844625 4:89473816-89473838 TGAACCCTGCTTCCTATGGAAGG - Intergenic
980410243 4:132408187-132408209 TAAACTGTGTTTCTTATAGAAGG + Intergenic
981439301 4:144764804-144764826 TGACATCTTCTTCCAATAGAAGG + Intergenic
982258671 4:153474219-153474241 AGACCTCTGTTTCGTGTAGTGGG + Intronic
982934299 4:161451765-161451787 AGAACTGTGTTTCCTATATATGG - Intronic
984505732 4:180615930-180615952 TAACCTAAGTCTCCTATAGAGGG - Intergenic
985013582 4:185608948-185608970 TGACTCCTGTGTCCTATAGTAGG + Intronic
985338145 4:188918114-188918136 TGACATGTTTTTCCAATAGAAGG + Intergenic
985891001 5:2715211-2715233 TGACATCTGTGTCCTATAGTTGG + Intergenic
986738701 5:10686857-10686879 TGACATCTTTTTCCAATAAAAGG - Intronic
987529428 5:19098272-19098294 TGGCATCTTTTTCCAATAGAAGG - Intergenic
989088489 5:37702021-37702043 TGACCTCTAAGTCCTATAGTTGG + Intronic
991158446 5:63466544-63466566 TGACCTCTGCTTGCTACTGAAGG - Intergenic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
993125659 5:83833020-83833042 TAACCACTATTGCCTATAGACGG + Intergenic
993620396 5:90161489-90161511 TGACCAATGCTTCCTCTAGAAGG + Intergenic
995505731 5:112859004-112859026 TGGCATCTTTTTCCAATAGAAGG + Intronic
996230549 5:121058531-121058553 GGACCTCTGTTTCCCATCAATGG + Intergenic
996623594 5:125541184-125541206 TGACCTCTGGTTCCCACAGGAGG + Intergenic
996673256 5:126144286-126144308 TGACATCTCCTTCCAATAGAAGG - Intergenic
999302369 5:150499127-150499149 TGACCTCTGTTTTCTTAAAAGGG - Intronic
999524720 5:152392230-152392252 TGACATCTGTTCACTAGAGAGGG + Exonic
1000131138 5:158300818-158300840 TTACCTCTGTTTCCTTTATTGGG - Intergenic
1000246625 5:159453720-159453742 TGAACCATGTTTCCTATAGGGGG - Intergenic
1000529585 5:162402882-162402904 TGATCTCCCCTTCCTATAGATGG + Intergenic
1000920115 5:167128288-167128310 CGACCTCAGTTTACTATGGAAGG + Intergenic
1003140859 6:3470048-3470070 TGAGTTCTGTTTCCAATAGTGGG - Intergenic
1003719384 6:8683303-8683325 TGACCCCTGGTTCCTATGGAAGG + Intergenic
1003893797 6:10587744-10587766 TAAACTCTGTTTCCCATAGGTGG + Intronic
1004188404 6:13442483-13442505 TGACATCTTTTTCCAAGAGATGG - Intronic
1004645480 6:17556009-17556031 AGGCCTCTGTTTCCTACAGATGG + Intronic
1005261282 6:24063564-24063586 TGGCATCTGTTTCCTCAAGAAGG + Intergenic
1005320494 6:24648123-24648145 TCACATCTGTGTCCTAAAGAAGG - Intergenic
1009387345 6:63101328-63101350 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1009509201 6:64526959-64526981 TGTGCTCTGTTTTGTATAGATGG - Intronic
1011737315 6:90324361-90324383 TGACATCTTCTTCCAATAGAAGG + Intergenic
1012291609 6:97462577-97462599 TCACCTCTGATTCAAATAGATGG + Intergenic
1012472297 6:99585877-99585899 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1013739848 6:113269618-113269640 TGACATCTTCTTCCAATAGAAGG - Intergenic
1013823811 6:114186719-114186741 TGGCATCTTTTTCCAATAGAAGG - Intronic
1015192124 6:130483091-130483113 TGACCTGGGTGTCCTATAGGAGG + Intergenic
1016559209 6:145375929-145375951 TGACCTGTGTTTTCCAAAGAGGG - Intergenic
1018224210 6:161612273-161612295 TGACATCTTCTTCCAATAGAAGG - Intronic
1018342765 6:162868749-162868771 TGCCCTGTCTTTCCTGTAGATGG + Intronic
1018764618 6:166923718-166923740 TGAGCTACGTTTCCCATAGAAGG - Intronic
1019821426 7:3246102-3246124 TGACCCCTGTGTCCTCTAAATGG + Intergenic
1020495910 7:8853187-8853209 TGACAGCTATTTCCTATAGGTGG - Intergenic
1021132747 7:16930871-16930893 TGACATCTTTTTCCAATATATGG + Intergenic
1021452479 7:20795778-20795800 TGCCCTCTGTTCCATCTAGAAGG - Intergenic
1021480171 7:21106867-21106889 TGACTTCTGTGCCCCATAGAGGG + Intergenic
1023472830 7:40543212-40543234 TGATCTCTGCTTCCTACAGCAGG - Intronic
1023499994 7:40837953-40837975 TGAGGTCTGTTGCCTATGGATGG + Intronic
1023521813 7:41056981-41057003 TGACCTCATTTTCTTATAGCAGG - Intergenic
1024504587 7:50151129-50151151 TGAGCTCTGTTTCATAATGAAGG - Intronic
1024986224 7:55195316-55195338 TGGCCTCTGTTACCCAGAGATGG + Intronic
1025841151 7:65150883-65150905 ACACCTCTTTTTCCTATACAAGG - Intergenic
1025881893 7:65545063-65545085 ACACCTCTTTTTCCTATACAAGG + Intergenic
1025891548 7:65657569-65657591 ACACCTCTTTTTCCTATACAAGG - Intergenic
1027753524 7:82181720-82181742 TGACTTCTGTTTCCTTTACAAGG - Intronic
1028864774 7:95695728-95695750 AAACCTCTGTTTCCAACAGATGG + Intergenic
1029125546 7:98292629-98292651 TGACCTCTGGTGCCTGGAGAAGG - Exonic
1029894883 7:103972596-103972618 TGACTTCTGTTTGGAATAGAGGG + Intronic
1030702845 7:112660515-112660537 TGCCCTCTGTGTCCTTTAGTTGG + Intergenic
1032701702 7:134386142-134386164 TGACATCTTCTTCCAATAGAAGG - Intergenic
1036229167 8:6984902-6984924 TGTCCTCTGTTGCCCATGGAGGG + Intergenic
1036231620 8:7004007-7004029 TGTCCTCTGTTGCCCATGGAGGG + Intronic
1036965466 8:13292548-13292570 TGATCTTTGTTTTGTATAGATGG + Intronic
1037457556 8:19079029-19079051 GGCCCTCTGCTTCCTATAGGTGG + Intronic
1037483791 8:19328814-19328836 TTACCTCTGTTTACTATAGAAGG + Intronic
1038046169 8:23767306-23767328 TGGCCTATGATTCCTATAGAAGG - Intergenic
1038087470 8:24215903-24215925 TGAACTCTGTCTCCACTAGAAGG - Intergenic
1039076754 8:33697164-33697186 TGACATCTTCTTCCAATAGAAGG + Intergenic
1039974329 8:42348162-42348184 TGACGTATGTTTCCTAAGGAAGG + Intronic
1042474932 8:69237032-69237054 AGAGCTCTGTTTCCTGTTGAAGG + Intergenic
1042761083 8:72272131-72272153 GGAAGTCTGTGTCCTATAGAAGG + Intergenic
1043201388 8:77373761-77373783 TGACTTCTCCTTCCTAGAGAGGG + Intergenic
1045670346 8:104544441-104544463 TGACATCTTCTTCCAATAGAAGG - Intronic
1046273314 8:111924354-111924376 TAACCTCTGTTTCCTATGAAAGG + Intergenic
1050349542 9:4727301-4727323 TGGCATCTTTTTCCAATAGAAGG + Intronic
1055554055 9:77458170-77458192 TGTCCTGTCTTTCCTCTAGATGG + Intronic
1055748736 9:79480171-79480193 TTACCCCAGTTTCCCATAGACGG - Intergenic
1057984540 9:99698462-99698484 TGTCATCTGCTTCCAATAGAAGG - Intergenic
1058285798 9:103176613-103176635 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1061902586 9:133680586-133680608 TGACCTCTGCCTCCTCTTGAGGG - Intronic
1186849171 X:13563232-13563254 TGGCATCTTCTTCCTATAGAAGG + Intergenic
1187129811 X:16491617-16491639 TGGTCTCTGGTTTCTATAGAGGG - Intergenic
1187318956 X:18223357-18223379 TGACCTCTGTTCTCCATGGAAGG + Intergenic
1189263648 X:39696565-39696587 TGGCATCTTTTTCCAATAGAAGG + Intergenic
1190171918 X:48118025-48118047 TGGCATCTGCTTCCAATAGAAGG + Intergenic
1193696520 X:84713332-84713354 TGAGCTTTATTTCCTTTAGAAGG + Intergenic
1195316509 X:103684753-103684775 TCACCTCTGTTTCATATACGAGG + Intronic
1196464692 X:115960176-115960198 TGCAGTCTGTTTCCTTTAGAGGG - Intergenic
1201478716 Y:14413630-14413652 TGACATCAGTTTCCTCTACAAGG + Intergenic
1202258702 Y:22946696-22946718 TAACATCTGTTTGCTATAGCAGG - Intergenic
1202411691 Y:24580454-24580476 TAACATCTGTTTGCTATAGCAGG - Intergenic
1202459091 Y:25089618-25089640 TAACATCTGTTTGCTATAGCAGG + Intergenic