ID: 967225475

View in Genome Browser
Species Human (GRCh38)
Location 3:187287171-187287193
Sequence CAGGGTAAAGCGTCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967225472_967225475 -1 Left 967225472 3:187287149-187287171 CCACACTGTTCTACTGTGTCTGC 0: 1
1: 0
2: 1
3: 11
4: 231
Right 967225475 3:187287171-187287193 CAGGGTAAAGCGTCTGCTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
967225470_967225475 30 Left 967225470 3:187287118-187287140 CCAAAGCTGATTTTCTCAAACAC 0: 1
1: 0
2: 4
3: 31
4: 257
Right 967225475 3:187287171-187287193 CAGGGTAAAGCGTCTGCTCCTGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967225475 Original CRISPR CAGGGTAAAGCGTCTGCTCC TGG Intronic
903766689 1:25739792-25739814 CAGGGTTAAGTGTCTACTCCAGG - Intronic
904106823 1:28091810-28091832 CAAGGTACAGCTTCTGCTCTGGG - Intergenic
906069753 1:43007991-43008013 CAGGGCAAAGCGGGTGCCCCAGG - Intergenic
909956827 1:81788626-81788648 GAAGGTAAAGCCTCTCCTCCTGG + Intronic
911324953 1:96460264-96460286 CAGGGGTAAGCCACTGCTCCCGG - Intergenic
916526217 1:165611896-165611918 CAGGGTAGAGCCACTGCGCCCGG - Intergenic
916742120 1:167655229-167655251 CTTGTTAAAGCGTCTGGTCCAGG + Intronic
923745489 1:236696027-236696049 CAGGCTTAAGCCTCTGCGCCTGG - Intronic
924899976 1:248387628-248387650 GAGGGTAAAGCCTCTGGTCAAGG - Exonic
1063140852 10:3255396-3255418 CAGGCTAGAGCCACTGCTCCTGG - Intergenic
1065079060 10:22110150-22110172 CAGTGTCTAGTGTCTGCTCCTGG + Intergenic
1070907076 10:80082345-80082367 CTGGGTACTGCCTCTGCTCCAGG - Intronic
1074853493 10:117456980-117457002 CAGGGCTAAGCCCCTGCTCCGGG - Intergenic
1075908301 10:126102073-126102095 CAGGGAAAAGCAACTCCTCCAGG + Intronic
1078904692 11:15672858-15672880 CTGAGGAAAGTGTCTGCTCCAGG - Intergenic
1079360702 11:19768072-19768094 CAGGGCACAGGGTCTCCTCCAGG + Intronic
1079458209 11:20655112-20655134 CAGGGTAAAACGTGTGGTCAGGG - Exonic
1079967258 11:26994477-26994499 CTGGGTAAAAAGTCTCCTCCTGG + Exonic
1082784659 11:57310264-57310286 CAGAGTAAAGTGTCTGCCCCAGG - Exonic
1082934802 11:58645555-58645577 CAGGGTATAGCCCCTGATCCTGG + Intronic
1083172496 11:60931309-60931331 GAGGGTCAAGTGTCTGGTCCTGG + Intronic
1083886002 11:65573837-65573859 TAGGGTACAGCCTCTGCTCATGG + Exonic
1083922875 11:65789938-65789960 CAGGGGAAAGATTCTGCCCCGGG - Intronic
1083998019 11:66281834-66281856 CAGGGTTAAGCGCCCACTCCAGG + Intronic
1084369046 11:68726140-68726162 CAGGGTAGAAGGTCTGCTGCAGG + Intronic
1088610306 11:111570127-111570149 CATGGTAAAGTGTATGCTGCAGG - Intergenic
1088776008 11:113083879-113083901 CAGGGACAAACGTCTGCTCTGGG - Intronic
1090040416 11:123285761-123285783 CAGGCATAAGCCTCTGCTCCTGG - Intergenic
1091783631 12:3229496-3229518 AAGGGGAAAGCCTCTGATCCTGG - Intronic
1096188313 12:49598598-49598620 CAGGATAAAGCCTCTGCACCAGG - Intronic
1099845049 12:88018651-88018673 CAGGGTAGAGCCCCTGCTCCTGG - Intronic
1103611591 12:122127428-122127450 CAGGGACCAGAGTCTGCTCCTGG + Intronic
1103728559 12:123011346-123011368 CAGGGCATATGGTCTGCTCCAGG - Intronic
1108495969 13:51025769-51025791 CAGAGCAGAGCGTGTGCTCCGGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113269339 13:108655672-108655694 CAGGGTATAGCCCCGGCTCCTGG - Intronic
1113801312 13:113087896-113087918 AAGTGTACAGCGGCTGCTCCTGG - Intronic
1119219258 14:72893181-72893203 GAGGGGGCAGCGTCTGCTCCCGG - Intronic
1121544979 14:94756549-94756571 CAGAGTCAAGCCACTGCTCCTGG + Intergenic
1128864956 15:71107884-71107906 CAGGGTTAAGCCACTGCTCAAGG + Intronic
1137334032 16:47530427-47530449 CAGGGGAAAGCCACTGCGCCTGG + Intronic
1141514215 16:84532513-84532535 CAGGGCAAGGCCTCAGCTCCAGG + Intronic
1143267900 17:5654182-5654204 CAGGGACAATCATCTGCTCCTGG - Intergenic
1146139359 17:30351428-30351450 CAGGCTAGAGCCACTGCTCCCGG + Intergenic
1146691975 17:34882932-34882954 CAGGGCACACAGTCTGCTCCTGG + Intergenic
1146828751 17:36047900-36047922 CAGGGCAAAGCCTCTTCCCCCGG - Intergenic
1148324593 17:46775969-46775991 CAAGGAAAAGCCTCTGCTCAGGG - Intronic
1152079106 17:78175510-78175532 GAAGGTAAGGCGTCTGATCCAGG - Exonic
1152435348 17:80273076-80273098 CAGGGTAGGGGTTCTGCTCCAGG - Intronic
1156258821 18:35425533-35425555 CAGGCATAAGCGACTGCTCCTGG + Intergenic
1156454658 18:37286200-37286222 CAGGGCAAAGAATCTACTCCAGG + Intronic
1161722204 19:5909303-5909325 CTGGGTTAAACGTCTGCACCTGG - Exonic
1162310759 19:9905826-9905848 CAGGGTATAGCGCCTGTGCCAGG - Intronic
1162685320 19:12378063-12378085 CAGGGGTAAGCCACTGCTCCTGG + Intergenic
1165621341 19:37251352-37251374 CAGGGTCAAGAGCATGCTCCTGG + Intergenic
1166378816 19:42343982-42344004 CAGACCACAGCGTCTGCTCCCGG + Exonic
1166782218 19:45348700-45348722 CAGGGCCCAGCGTCTGCTCCCGG - Exonic
1166811699 19:45518143-45518165 CAGGGTAAAGCGGCAGCCCCAGG - Intronic
928574345 2:32639724-32639746 CAGGTGAAAGCTTCTGCGCCTGG - Intronic
928917051 2:36483568-36483590 CAGGGTCCAGGGTCTGGTCCTGG - Intronic
929617086 2:43319744-43319766 CAGGGTAATGAGTCTGCAACTGG - Intronic
932833032 2:75008915-75008937 CAAGGGTAAGCGTCTGTTCCTGG + Intergenic
942819303 2:180092657-180092679 CAGGATAAAGAATCTACTCCAGG + Intergenic
946732196 2:222720542-222720564 CAGGGTATAGTCCCTGCTCCTGG + Intergenic
1171208430 20:23299014-23299036 CAGGGCACAGGGTCTCCTCCTGG - Intergenic
1172523367 20:35583238-35583260 GAGGGCTCAGCGTCTGCTCCAGG + Intergenic
1173457057 20:43211358-43211380 CAGGGTAAAACGTGTAATCCAGG - Intergenic
1175735771 20:61386058-61386080 CAAGGTAGGGGGTCTGCTCCTGG - Intronic
1183225720 22:36548691-36548713 CAGGGGAGAGCGGCTGCTGCGGG + Intergenic
1185104070 22:48857526-48857548 CAGGGTGATGGGTCTGCTCAAGG + Intergenic
953876834 3:46671422-46671444 AAGGGAAAAGGGTCTGCCCCAGG + Intronic
957790865 3:84939656-84939678 CAGGGTATAGCGTGTGCACAGGG + Intergenic
958801853 3:98765126-98765148 CAGGCTCAAGAGTCTGCACCAGG - Intronic
965646556 3:170887954-170887976 AAGGGTGAAGCGTTTGCTTCAGG + Intergenic
965763184 3:172102703-172102725 CTGGGTAAAGCGTGAGCTTCTGG + Intronic
967225475 3:187287171-187287193 CAGGGTAAAGCGTCTGCTCCTGG + Intronic
968578198 4:1377635-1377657 CAGGGCAAAGCCTGTGGTCCTGG - Intronic
969439855 4:7210574-7210596 CAAGGTCAAGCGTTTGATCCAGG - Intronic
974077250 4:57178553-57178575 GAAGGTAAAGTGTTTGCTCCAGG + Intergenic
975049114 4:69837806-69837828 CAGGTGAAAGCCACTGCTCCTGG + Intronic
979518158 4:121635318-121635340 CAGGCTTAAGCCACTGCTCCTGG + Intergenic
981919399 4:150070266-150070288 TAGGGTAAAACTTTTGCTCCAGG + Intergenic
987299276 5:16582623-16582645 CAGGGGAAACCCTCTGCTCATGG + Intronic
988170782 5:27652673-27652695 CAGGGTACAGCGCCACCTCCTGG - Intergenic
989335303 5:40309266-40309288 CAGGATAAAACGTTGGCTCCAGG - Intergenic
989400441 5:41002345-41002367 GAGGGTAAAGCGATTGCTCAGGG + Intronic
991913891 5:71587366-71587388 CAGGGGAAAGCACCGGCTCCAGG + Exonic
991994829 5:72376600-72376622 CTGGGTAAAGAGTGTGCTCTTGG + Intergenic
995250786 5:109991092-109991114 CAGGGTAAAGCGCATTCTACAGG + Intergenic
999620050 5:153463603-153463625 CAGGCAAAAGCCACTGCTCCAGG + Intergenic
1002965461 6:1961852-1961874 CAGGGGACAGCTTCTGCTCCAGG - Intronic
1003635333 6:7826712-7826734 CAGAGCAAAGCGTCTGCTGCAGG + Intronic
1005969481 6:30749946-30749968 CAGGGTGAAGGGACTGCACCAGG + Intergenic
1006919643 6:37619051-37619073 CAGGGCAGAGGGGCTGCTCCAGG + Intergenic
1009501481 6:64419777-64419799 CAGGGTACAGCATCCCCTCCTGG + Intronic
1011313792 6:86009179-86009201 CAGATTAAAGGGTCTGCTACTGG + Intergenic
1011381318 6:86744804-86744826 CATGGTGCAGCGTCTGCTTCTGG - Intergenic
1013394608 6:109722768-109722790 CAGGGTAGAGGCTCTACTCCAGG - Intronic
1020871777 7:13639624-13639646 CAGGGTAAAGCAGCTGTTCTGGG - Intergenic
1021683320 7:23156736-23156758 CAGGGTAAACCTTCTGAACCTGG - Intronic
1024326014 7:48109744-48109766 CATGCTAAAGGCTCTGCTCCTGG + Intergenic
1027682106 7:81233702-81233724 CAGGGTGGAGCCTGTGCTCCTGG - Intergenic
1036402856 8:8425879-8425901 CAGGGTGAAGCATCTGCCCTTGG - Intergenic
1037673358 8:21034345-21034367 CAGAGAAAAACGTCTGCTTCAGG + Intergenic
1044729011 8:95215346-95215368 CAGGTTAAATCGTTTGCTTCAGG - Intergenic
1048396642 8:134020252-134020274 TAGGGAAAAGAGACTGCTCCAGG - Intergenic
1048540038 8:135334113-135334135 CAGGATCAAGAGTCTGCTCCAGG - Intergenic
1052028581 9:23602687-23602709 CAGAGTAAGGCATCTGCCCCAGG - Intergenic
1055800695 9:80032615-80032637 CAGGGTACACCCTCTGCACCTGG + Intergenic
1056708307 9:88970044-88970066 CAGGGCTGAGCGTCTGCTCTAGG - Intergenic
1056805993 9:89729182-89729204 CAGGGTGGAGAGTCTGGTCCTGG + Intergenic
1057517278 9:95732426-95732448 GAGGGAAAAGAGTGTGCTCCAGG + Intergenic
1057547900 9:96031775-96031797 CAGGGTCAAGCTTGTGTTCCTGG - Intergenic
1059438067 9:114288411-114288433 TAGGGCAAACCGCCTGCTCCTGG - Intronic
1061310206 9:129757123-129757145 CAGGGCAGAGCCTCTGCTCAGGG - Intergenic
1062100472 9:134725346-134725368 CAAGGTAAAGAGCCTGCACCTGG - Intronic
1062606103 9:137349551-137349573 CAGGGTAACGCGTCTGGCCCTGG + Intronic
1187894364 X:23966701-23966723 CAGGGTACAGCCCCCGCTCCTGG + Intergenic
1190855379 X:54289241-54289263 CAGTGTAAAGAGGATGCTCCAGG + Intronic
1193482484 X:82044491-82044513 CAGGGTACAGCCTCACCTCCTGG - Intergenic
1196719438 X:118839741-118839763 CAGGGTGAGGTGTCTGTTCCCGG - Intergenic