ID: 967226150

View in Genome Browser
Species Human (GRCh38)
Location 3:187293303-187293325
Sequence CTGTGCTTGTAGAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967226150 Original CRISPR CTGTGCTTGTAGAAGTGTCC AGG Intergenic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900688700 1:3966198-3966220 CTGGGCTTGGGGTAGTGTCCTGG + Intergenic
903829633 1:26166820-26166842 CTGTGGTTGTATAAGTGCACAGG - Intergenic
905310063 1:37042957-37042979 CTGTGCTTCTCTGAGTGTCCTGG - Intergenic
906460473 1:46032245-46032267 CCCTGCTTGGAGAAGAGTCCCGG - Exonic
906708273 1:47910607-47910629 TTGAGCTTCAAGAAGTGTCCTGG - Intronic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
918715359 1:187779518-187779540 CTGGGCTTCTAATAGTGTCCTGG + Intergenic
924028732 1:239865884-239865906 CTGTGCTCAGAGAAGTGCCCAGG + Intronic
1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG + Intronic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1065325758 10:24549553-24549575 CTGTGCTTCTATCAGGGTCCAGG - Intergenic
1066708046 10:38202509-38202531 CTGTGGTTGTATGAGTGCCCCGG - Intergenic
1068119866 10:52774496-52774518 CTGTGCCTGGAAAAATGTCCAGG + Intergenic
1068211994 10:53932355-53932377 CTGTGCTTCTATAAGTATGCAGG - Intronic
1070245817 10:74730468-74730490 CTGTGATGGGAGGAGTGTCCTGG - Intergenic
1072460722 10:95616367-95616389 GTCTGCTTGTAGTAGTGTCTTGG + Intronic
1075180383 10:120205793-120205815 CTCAGCATGCAGAAGTGTCCAGG - Intergenic
1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG + Intronic
1076647903 10:131966037-131966059 ATGTGCATGTAGAAGTTTCTAGG + Intergenic
1076934541 10:133558710-133558732 CTCTGCTTGTGGGAGTGTTCAGG - Intronic
1081521938 11:43890308-43890330 CTGAGCTTGTAAAAGTGACACGG + Intronic
1088237522 11:107741673-107741695 CTGCTCTTGTAGGAGTGGCCAGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1091628125 12:2138347-2138369 CTGTGCTTGCAGATGGATCCTGG + Intronic
1092887667 12:12939214-12939236 GTGTGCCTCTAGAAGGGTCCCGG - Intergenic
1093119713 12:15254139-15254161 CTCTGCTTCTAGCAGTGCCCTGG + Intronic
1094447307 12:30545911-30545933 CTGTGCTGGTAGAGGTGGCAGGG + Intergenic
1094742343 12:33303849-33303871 CTGTGATTGTACTAGTGTACAGG - Intergenic
1095234620 12:39781878-39781900 CTGTACTTGCAGAGGTGTCTAGG + Intronic
1096791902 12:54050609-54050631 CTGTGCTTGTAATAATATCCAGG + Intronic
1099531217 12:83783769-83783791 CTGTGCTCTTAGAAGTGTATAGG - Intergenic
1103338278 12:120206599-120206621 CTCTGATTGTAAAGGTGTCCAGG - Intergenic
1104509251 12:129361028-129361050 CTTTGCAGGTGGAAGTGTCCCGG - Intronic
1105567135 13:21560749-21560771 TTATGCTTGTAGAAATGTCTAGG + Intronic
1106802523 13:33270949-33270971 CTCTGCTTGTGGGAGTGTGCAGG - Intronic
1107962877 13:45574660-45574682 CTGTGCTTGTTGGAGTTTCTGGG + Intronic
1109791940 13:67260143-67260165 CTGTTTTTGTCGAAGAGTCCTGG + Intergenic
1110792194 13:79598840-79598862 CTGTGGTTGAAGAAATGACCAGG - Intergenic
1112789864 13:102991494-102991516 TTGTGCTTTTAAAAGTTTCCTGG + Intergenic
1119452406 14:74723162-74723184 CTGTCATTGCAAAAGTGTCCTGG + Intronic
1121741297 14:96254131-96254153 CTGTGCTTGATGAAGTCCCCTGG - Intronic
1127792523 15:62410994-62411016 CTATTCTTGTAGAAGAGCCCTGG + Intronic
1128820898 15:70652284-70652306 CTGTGTTTCTAGTAGTTTCCAGG - Intergenic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG + Exonic
1133714436 16:8433351-8433373 TTGTGCCTGTGGAAGTCTCCCGG - Intergenic
1138053883 16:53812188-53812210 CTCTGGTTGTAGAGGTGTCAGGG - Intronic
1138265357 16:55656288-55656310 CTGTGGCTGTTGAAGTGTCGCGG + Intronic
1139571980 16:67818654-67818676 CTGGGCTTCTCGAACTGTCCTGG - Intronic
1142521379 17:507277-507299 CTCTGCTTGCAGAAGTGAACAGG - Intergenic
1146822393 17:35994104-35994126 CTGTGCTTGTAGCTTTATCCTGG - Intronic
1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG + Intergenic
1150707976 17:67505150-67505172 CAGTGCATGTGGAAGTCTCCAGG - Intronic
1151321477 17:73355074-73355096 CTGTCCTTGCAGAAGGCTCCGGG + Intronic
1157557307 18:48621357-48621379 CTGGGCTGGAAGAAGAGTCCGGG + Intronic
1165205226 19:34178684-34178706 TTGTTCTTGTAGAAGTATCTTGG + Intronic
1166326717 19:42055359-42055381 CTCTGCGCGTAGAAGTGTCTTGG + Intronic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
926476513 2:13329228-13329250 CTGTGCTCTCAGAAGGGTCCAGG + Intergenic
926708840 2:15859033-15859055 CTGTGCTTTTAGAGGTCACCTGG - Intergenic
926798849 2:16641120-16641142 CTGTGTGTGCAGAACTGTCCAGG - Intronic
926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG + Intergenic
927583141 2:24273406-24273428 CTAGGCTTGGAAAAGTGTCCCGG - Intronic
929375444 2:41281486-41281508 CTGTGGTTATAGAAGTGTTAGGG + Intergenic
929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG + Intergenic
929784877 2:44982235-44982257 CTGTGCTTGAATAAGCCTCCAGG - Intergenic
930873963 2:56193140-56193162 CGGTGCTTCTGGAAGTGTTCCGG - Exonic
931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG + Intronic
932144311 2:69305289-69305311 CTGTGCTTGTCCAAGCCTCCAGG + Intergenic
933755813 2:85637635-85637657 CTGTGCTGGTTTAAGTGTTCTGG + Intronic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
939103264 2:137920424-137920446 CTGTGTTTGTTGCAGGGTCCAGG - Intergenic
940144158 2:150527813-150527835 CTGTGCTTGTGGAATTGTCAGGG - Intronic
940853888 2:158714837-158714859 CTGTGCTTGTTGCTGTTTCCAGG + Intergenic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG + Intergenic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
1173720333 20:45252892-45252914 CTGTGCTTGGAGTAGGGTTCAGG + Intronic
1179648822 21:42793372-42793394 TTCTGCTTGTAAGAGTGTCCAGG - Intergenic
1182932919 22:34192060-34192082 CTGTGACTGTACAAGTTTCCTGG - Intergenic
951259571 3:20491047-20491069 CTGTGCTTTTAAAATTCTCCTGG + Intergenic
958594196 3:96201071-96201093 CTGTGCTTGTTGAGGTGTAATGG - Intergenic
959243770 3:103835806-103835828 CTTTGCTTGAACAAATGTCCTGG - Intergenic
959649247 3:108735844-108735866 CTGTCCCTGCAGAGGTGTCCAGG + Intergenic
960439601 3:117670498-117670520 CTGAGCCTGAAGAAGTGTGCAGG - Intergenic
960638263 3:119804907-119804929 GTGTGCTTGTTGAAATGTCTAGG - Intronic
960855975 3:122102588-122102610 CTATGGTTGTAAAATTGTCCAGG + Intronic
961916826 3:130384660-130384682 CTGTGCTTAATGAAGTGTGCAGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962739598 3:138353433-138353455 CTGTGTCTCTAGAAGGGTCCAGG - Intronic
963059405 3:141212725-141212747 ATGTGCAGGTAGCAGTGTCCTGG + Intergenic
964309608 3:155378692-155378714 CTGTGTTTCTAGTAGTTTCCAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968293470 3:197555954-197555976 CTTCGCGTGTAGAAGCGTCCGGG - Exonic
969442714 4:7226798-7226820 CGGTGCTTGAAGATGTGGCCTGG - Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
974170074 4:58255081-58255103 CTGTGCTGTTAAAAGTGTCTTGG - Intergenic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
983835877 4:172383585-172383607 CTTTGCTTGCATAATTGTCCTGG + Intronic
983867398 4:172784989-172785011 CTGTCCTTGTGGAGATGTCCTGG - Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
987985756 5:25143515-25143537 CTGTCCTGGTAGAATTGCCCTGG - Intergenic
990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG + Intergenic
992996313 5:82337406-82337428 ATGTGGTTGGAGAAGTGTCATGG + Intronic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999101469 5:149029109-149029131 CTGTGCTGGGAGTTGTGTCCTGG - Intronic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1005677718 6:28172871-28172893 CTGTGCATGCTGAGGTGTCCTGG + Intergenic
1006721792 6:36159274-36159296 CTTTTGTTGTAGAAGTTTCCTGG - Intergenic
1012491501 6:99787619-99787641 CAGGGCCTGGAGAAGTGTCCAGG + Intergenic
1013292922 6:108734069-108734091 CTGTGATTGCACAAGTCTCCAGG - Intergenic
1016029256 6:139321126-139321148 CTGTCAGTGTAGAAGTGCCCCGG + Intergenic
1016042897 6:139450755-139450777 CTGTGATTTGAGAAGTGTTCAGG + Intergenic
1016764280 6:147774655-147774677 CTGTGGTTGTAGAAGAGTGGAGG + Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1023599536 7:41867715-41867737 TTGTACTTTCAGAAGTGTCCAGG - Intergenic
1024685323 7:51738387-51738409 CTGTGCAGACAGAAGTGTCCAGG + Intergenic
1026277022 7:68888933-68888955 CTGTGCTTTTAGAATTGGGCAGG + Intergenic
1026960360 7:74404020-74404042 CTGGGCTTGAGGAAGCGTCCTGG - Exonic
1027584328 7:80039012-80039034 CTGTGCTTTTAAAAGTGTTCAGG + Intergenic
1028871769 7:95778231-95778253 CTGTGGTTGTAGAATTATTCGGG - Intronic
1029737221 7:102471669-102471691 GTCTGCTTGGAGAAGTGTCCCGG - Intronic
1032991052 7:137395484-137395506 CTGTGCTTATGGAAGTGCCTGGG - Intronic
1036917288 8:12816313-12816335 CAGTGCTTGGAGAAATCTCCAGG + Intergenic
1037405256 8:18535820-18535842 CAGTGATTGGAGAAGTATCCGGG + Exonic
1038445160 8:27598525-27598547 CGGTCCCTGTAGAAGTCTCCAGG - Exonic
1038681777 8:29675199-29675221 CTGTGTTTGAAGAAATTTCCTGG - Intergenic
1039001816 8:32989672-32989694 CTTTGCTTGGAGCAATGTCCTGG + Intergenic
1041707048 8:60857687-60857709 CACTGCTTGAAGAAGGGTCCAGG - Intronic
1046021189 8:108667114-108667136 ATGTGCTTTTCGAAGTGGCCAGG + Intronic
1046891792 8:119430235-119430257 GTGTGCTTCTGGAATTGTCCAGG - Intergenic
1049236875 8:141516701-141516723 CTCTGCTTGTAGAGGGGTCGAGG - Intronic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1062679699 9:137772207-137772229 TTGTGCTTGGAGAGGTGTGCTGG - Intronic
1193383579 X:80844848-80844870 CTATGCCTGTAGAAATATCCTGG - Intergenic
1194340689 X:92701219-92701241 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1196972462 X:121124474-121124496 CTGTGTTTGTTGATGTTTCCAGG + Intergenic
1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG + Intergenic
1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG + Intergenic