ID: 967228349

View in Genome Browser
Species Human (GRCh38)
Location 3:187314364-187314386
Sequence TTCAAGGACTCTTCTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967228349_967228357 18 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228357 3:187314405-187314427 TCTCCGAAGAAGGAAGGGGTAGG No data
967228349_967228359 26 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228359 3:187314413-187314435 GAAGGAAGGGGTAGGAGCCCAGG No data
967228349_967228355 13 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228355 3:187314400-187314422 CTTCATCTCCGAAGAAGGAAGGG No data
967228349_967228356 14 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228356 3:187314401-187314423 TTCATCTCCGAAGAAGGAAGGGG No data
967228349_967228360 27 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228360 3:187314414-187314436 AAGGAAGGGGTAGGAGCCCAGGG No data
967228349_967228354 12 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG No data
967228349_967228352 8 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228352 3:187314395-187314417 AGCTCCTTCATCTCCGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967228349 Original CRISPR TTCAAGGACTCTTCTCAGAA TGG (reversed) Intergenic
No off target data available for this crispr