ID: 967228350

View in Genome Browser
Species Human (GRCh38)
Location 3:187314380-187314402
Sequence AAGGAGCTGGCTTTTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967228350_967228359 10 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228359 3:187314413-187314435 GAAGGAAGGGGTAGGAGCCCAGG No data
967228350_967228352 -8 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228352 3:187314395-187314417 AGCTCCTTCATCTCCGAAGAAGG No data
967228350_967228354 -4 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG No data
967228350_967228364 30 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228364 3:187314433-187314455 AGGGAACTGTCATCTGGACCTGG No data
967228350_967228360 11 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228360 3:187314414-187314436 AAGGAAGGGGTAGGAGCCCAGGG No data
967228350_967228355 -3 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228355 3:187314400-187314422 CTTCATCTCCGAAGAAGGAAGGG No data
967228350_967228356 -2 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228356 3:187314401-187314423 TTCATCTCCGAAGAAGGAAGGGG No data
967228350_967228361 24 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228361 3:187314427-187314449 GAGCCCAGGGAACTGTCATCTGG No data
967228350_967228357 2 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228357 3:187314405-187314427 TCTCCGAAGAAGGAAGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967228350 Original CRISPR AAGGAGCTGGCTTTTCTTCA AGG (reversed) Intergenic
No off target data available for this crispr