ID: 967228354

View in Genome Browser
Species Human (GRCh38)
Location 3:187314399-187314421
Sequence CCTTCATCTCCGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967228349_967228354 12 Left 967228349 3:187314364-187314386 CCATTCTGAGAAGAGTCCTTGAA No data
Right 967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG No data
967228350_967228354 -4 Left 967228350 3:187314380-187314402 CCTTGAAGAAAAGCCAGCTCCTT No data
Right 967228354 3:187314399-187314421 CCTTCATCTCCGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967228354 Original CRISPR CCTTCATCTCCGAAGAAGGA AGG Intergenic
No off target data available for this crispr