ID: 967229842

View in Genome Browser
Species Human (GRCh38)
Location 3:187327133-187327155
Sequence AGGTGTATCCCTGACAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967229838_967229842 7 Left 967229838 3:187327103-187327125 CCTGAGTTTGAAATAGGTGAATT No data
Right 967229842 3:187327133-187327155 AGGTGTATCCCTGACAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967229842 Original CRISPR AGGTGTATCCCTGACAGTGG AGG Intergenic
No off target data available for this crispr