ID: 967233029

View in Genome Browser
Species Human (GRCh38)
Location 3:187358926-187358948
Sequence CAGGTTAAGAATTAAACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233029_967233038 25 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233038 3:187358974-187358996 CCTGGGCTACCACTTGGGAGAGG No data
967233029_967233035 19 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233035 3:187358968-187358990 AAAATTCCTGGGCTACCACTTGG No data
967233029_967233034 8 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233034 3:187358957-187358979 TATGCTATATCAAAATTCCTGGG No data
967233029_967233033 7 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233033 3:187358956-187358978 TTATGCTATATCAAAATTCCTGG No data
967233029_967233039 26 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG No data
967233029_967233036 20 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233036 3:187358969-187358991 AAATTCCTGGGCTACCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233029 Original CRISPR CAGGTTAAGAATTAAACACT TGG (reversed) Intergenic
No off target data available for this crispr