ID: 967233032

View in Genome Browser
Species Human (GRCh38)
Location 3:187358950-187358972
Sequence ATTTTGATATAGCATAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233032_967233036 -4 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233036 3:187358969-187358991 AAATTCCTGGGCTACCACTTGGG No data
967233032_967233040 8 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233040 3:187358981-187359003 TACCACTTGGGAGAGGGAGCTGG No data
967233032_967233039 2 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG No data
967233032_967233043 25 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233043 3:187358998-187359020 AGCTGGAGAGAGCAGTGAGTGGG No data
967233032_967233035 -5 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233035 3:187358968-187358990 AAAATTCCTGGGCTACCACTTGG No data
967233032_967233038 1 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233038 3:187358974-187358996 CCTGGGCTACCACTTGGGAGAGG No data
967233032_967233042 24 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233042 3:187358997-187359019 GAGCTGGAGAGAGCAGTGAGTGG No data
967233032_967233044 26 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233044 3:187358999-187359021 GCTGGAGAGAGCAGTGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233032 Original CRISPR ATTTTGATATAGCATAAAGA AGG (reversed) Intergenic
No off target data available for this crispr