ID: 967233039

View in Genome Browser
Species Human (GRCh38)
Location 3:187358975-187358997
Sequence CTGGGCTACCACTTGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233031_967233039 7 Left 967233031 3:187358945-187358967 CCTGGCCTTCTTTATGCTATATC No data
Right 967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG No data
967233029_967233039 26 Left 967233029 3:187358926-187358948 CCAAGTGTTTAATTCTTAACCTG No data
Right 967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG No data
967233032_967233039 2 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233039 3:187358975-187358997 CTGGGCTACCACTTGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233039 Original CRISPR CTGGGCTACCACTTGGGAGA GGG Intergenic
No off target data available for this crispr