ID: 967233040

View in Genome Browser
Species Human (GRCh38)
Location 3:187358981-187359003
Sequence TACCACTTGGGAGAGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233032_967233040 8 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233040 3:187358981-187359003 TACCACTTGGGAGAGGGAGCTGG No data
967233031_967233040 13 Left 967233031 3:187358945-187358967 CCTGGCCTTCTTTATGCTATATC No data
Right 967233040 3:187358981-187359003 TACCACTTGGGAGAGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233040 Original CRISPR TACCACTTGGGAGAGGGAGC TGG Intergenic
No off target data available for this crispr