ID: 967233043

View in Genome Browser
Species Human (GRCh38)
Location 3:187358998-187359020
Sequence AGCTGGAGAGAGCAGTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233032_967233043 25 Left 967233032 3:187358950-187358972 CCTTCTTTATGCTATATCAAAAT No data
Right 967233043 3:187358998-187359020 AGCTGGAGAGAGCAGTGAGTGGG No data
967233037_967233043 1 Left 967233037 3:187358974-187358996 CCTGGGCTACCACTTGGGAGAGG No data
Right 967233043 3:187358998-187359020 AGCTGGAGAGAGCAGTGAGTGGG No data
967233031_967233043 30 Left 967233031 3:187358945-187358967 CCTGGCCTTCTTTATGCTATATC No data
Right 967233043 3:187358998-187359020 AGCTGGAGAGAGCAGTGAGTGGG No data
967233041_967233043 -8 Left 967233041 3:187358983-187359005 CCACTTGGGAGAGGGAGCTGGAG No data
Right 967233043 3:187358998-187359020 AGCTGGAGAGAGCAGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233043 Original CRISPR AGCTGGAGAGAGCAGTGAGT GGG Intergenic
No off target data available for this crispr