ID: 967233666 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:187364992-187365014 |
Sequence | AATAACATGGGGCTTTCAAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
967233662_967233666 | 1 | Left | 967233662 | 3:187364968-187364990 | CCAGTTGGTCAGAAGCACAGGTA | 0: 14 1: 33 2: 97 3: 147 4: 320 |
||
Right | 967233666 | 3:187364992-187365014 | AATAACATGGGGCTTTCAACTGG | No data | ||||
967233660_967233666 | 13 | Left | 967233660 | 3:187364956-187364978 | CCTAATGTATAACCAGTTGGTCA | No data | ||
Right | 967233666 | 3:187364992-187365014 | AATAACATGGGGCTTTCAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
967233666 | Original CRISPR | AATAACATGGGGCTTTCAAC TGG | Intergenic | ||
No off target data available for this crispr |