ID: 967233666

View in Genome Browser
Species Human (GRCh38)
Location 3:187364992-187365014
Sequence AATAACATGGGGCTTTCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967233662_967233666 1 Left 967233662 3:187364968-187364990 CCAGTTGGTCAGAAGCACAGGTA 0: 14
1: 33
2: 97
3: 147
4: 320
Right 967233666 3:187364992-187365014 AATAACATGGGGCTTTCAACTGG No data
967233660_967233666 13 Left 967233660 3:187364956-187364978 CCTAATGTATAACCAGTTGGTCA No data
Right 967233666 3:187364992-187365014 AATAACATGGGGCTTTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967233666 Original CRISPR AATAACATGGGGCTTTCAAC TGG Intergenic
No off target data available for this crispr