ID: 967234214

View in Genome Browser
Species Human (GRCh38)
Location 3:187368511-187368533
Sequence ACATGGACGCTGAAGTTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967234207_967234214 -1 Left 967234207 3:187368489-187368511 CCAAGAGGCAAAACCCCGGGCCA 0: 1
1: 0
2: 1
3: 10
4: 88
Right 967234214 3:187368511-187368533 ACATGGACGCTGAAGTTGGATGG 0: 1
1: 0
2: 0
3: 14
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967234214 Original CRISPR ACATGGACGCTGAAGTTGGA TGG Exonic
903076309 1:20769659-20769681 ACCTGTACGCTGAGGTGGGAGGG - Intronic
903235377 1:21947086-21947108 ACATGGACCCTGCAGATGCATGG + Intergenic
903494149 1:23753205-23753227 GCATAGACTCTGAAGTTTGATGG + Intronic
905008525 1:34730726-34730748 AGATGGTTGCTGAAGTCGGAGGG - Intronic
905271881 1:36792717-36792739 ACATGGGCCCTGAAGCTGGGGGG + Intergenic
905727371 1:40264769-40264791 ACTTGGAGGCTGAGGTGGGAGGG + Intronic
905887011 1:41496846-41496868 ACATGGAGGCTGGTGTGGGAAGG + Intergenic
905976722 1:42180828-42180850 ACAGGGAAGCTGAGGTAGGAGGG + Intronic
909020323 1:70424159-70424181 ACATGGATGATGATGTTGGGAGG - Intronic
909988685 1:82194689-82194711 AAATGGAATATGAAGTTGGATGG + Intergenic
912119787 1:106455996-106456018 ACATGGAGTCTGATGTTTGAGGG + Intergenic
913221474 1:116664191-116664213 AGATGCAGGCTGAAGTGGGAAGG - Intronic
914457290 1:147847787-147847809 AAATGGATGCTGCAGATGGATGG + Intergenic
915033972 1:152907361-152907383 ACATTGACACTGAAGCTGAAAGG + Intergenic
917117782 1:171619941-171619963 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
918958571 1:191240578-191240600 ACCTGGAGTCTGAGGTTGGAGGG - Intergenic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
921309681 1:213830581-213830603 CCATGGCCGTTGAAGGTGGAGGG - Intergenic
921840511 1:219823167-219823189 ACTTAGACTCTGCAGTTGGATGG - Intronic
923957567 1:239040220-239040242 AAAAGGAGGCAGAAGTTGGAAGG + Intergenic
924293609 1:242563616-242563638 ACTTGGACTCTGATGTTTGAGGG - Intergenic
924812494 1:247415771-247415793 GCATGGACTCTGGAGTTTGAAGG + Intergenic
1063144054 10:3280454-3280476 AGATGGACGCAGAGGCTGGACGG - Intergenic
1070849485 10:79551984-79552006 ACATGGTCGAGGAAGTTGGGTGG + Intergenic
1071744562 10:88401814-88401836 ACATGGCTGCTGAATTGGGAGGG + Intronic
1075667415 10:124240960-124240982 CCACGGAGGCTGAACTTGGAAGG + Intergenic
1079182808 11:18208810-18208832 ACATGGAGCCTGATGTTCGAGGG - Intronic
1079751634 11:24206749-24206771 GCATGAACTCTGAGGTTGGATGG + Intergenic
1081521723 11:43888198-43888220 ACTCGGAGGCTGAAGTGGGAGGG - Intronic
1083414534 11:62517009-62517031 ACGGGGACGCTGGAGTTTGAAGG - Exonic
1083730802 11:64651528-64651550 AGATGCCCGATGAAGTTGGAGGG + Exonic
1084666630 11:70579855-70579877 GGATGGAAGCAGAAGTTGGAGGG + Intronic
1084696511 11:70758770-70758792 AGATGGAGGCAGAAGTTGGAGGG - Intronic
1085609295 11:77932912-77932934 ACATGGACACTGAAGGTGGGGGG + Intronic
1087198766 11:95324351-95324373 ACCTGGAGTCTGAAGTTTGAGGG - Intergenic
1090210091 11:124913749-124913771 ACTTGGAGTCTGATGTTGGAGGG + Intergenic
1090222040 11:125035045-125035067 ACTTGGAGTCTGATGTTGGAGGG + Intronic
1093802128 12:23386863-23386885 AGATGGTGGCTGAAGCTGGATGG - Intergenic
1093903694 12:24664465-24664487 ACATGAACGATGAACTTTGAGGG - Intergenic
1095603643 12:44042640-44042662 ACCTGGAGTCTGATGTTGGAGGG - Intronic
1095716222 12:45349765-45349787 ACATGGACTCTCAGGCTGGATGG - Intronic
1095903638 12:47354856-47354878 ACATGGAGTCTGATGTTTGAGGG + Intergenic
1096109196 12:49019112-49019134 ACAGGGGCGCTGAGGGTGGAGGG + Exonic
1097239451 12:57565043-57565065 TCAGTGACCCTGAAGTTGGAGGG + Intronic
1097391314 12:59017984-59018006 ACATACACCCTGGAGTTGGAGGG - Intergenic
1097581559 12:61463726-61463748 ACTTGGAGTCTGAAGTTTGAGGG + Intergenic
1098678491 12:73321206-73321228 CCATGGACACTCAAGTTGGCAGG + Intergenic
1099750025 12:86761748-86761770 AGATGGAAGCAGAGGTTGGAGGG - Intronic
1104285736 12:127423039-127423061 CTATGCATGCTGAAGTTGGATGG + Intergenic
1105329634 13:19403321-19403343 TCAGGGACGCTGGAGTTGCAGGG + Intergenic
1106899757 13:34342778-34342800 ACATGGAGTCTGATGTTCGAGGG + Intergenic
1110161094 13:72379650-72379672 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
1111712236 13:91831222-91831244 ACTTGGAGTCTGATGTTGGAGGG + Intronic
1112255716 13:97829078-97829100 CTCTGGAGGCTGAAGTTGGAAGG - Intergenic
1115068419 14:29293954-29293976 ACATGGAGTCTGATGTTTGAGGG + Intergenic
1115427667 14:33279397-33279419 ACATGGACACGGAGGTTGGAAGG + Intronic
1115914920 14:38301624-38301646 ACATGGACACTGGAGCTGGCAGG + Intergenic
1116103068 14:40465983-40466005 ACATGCAGGCTGAAGATGAATGG - Intergenic
1119775979 14:77249015-77249037 ACAGGGCAGCTGAGGTTGGATGG + Intronic
1120760934 14:88284577-88284599 ACTTGGAGTCTGATGTTGGAGGG + Intronic
1122916402 14:104860979-104861001 ACATGGACGCTGGAGATAGAGGG - Intergenic
1124711540 15:32016696-32016718 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
1127577376 15:60304971-60304993 ACTTGGAGTCTGATGTTGGAGGG + Intergenic
1128970814 15:72103878-72103900 ACAAGGATGGTGAGGTTGGAGGG + Intronic
1131431703 15:92393728-92393750 GCCTGGACGCTGGAGTTGGTGGG + Intergenic
1131896514 15:97037178-97037200 ACTTGGAGGCTGATGTTCGAGGG - Intergenic
1133391485 16:5413885-5413907 ACATGGACGCAGGAATGGGAAGG - Intergenic
1136346454 16:29679196-29679218 CCATGGACGCTGAAGGTAAAGGG + Exonic
1139822452 16:69731271-69731293 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
1142205476 16:88780879-88780901 CCCTGGAGGCTGAAGTTGTAGGG + Intronic
1203139593 16_KI270728v1_random:1752525-1752547 ACATGTACTCTGAAGTCAGATGG + Intergenic
1143067964 17:4264568-4264590 AAGAGGACGCTGAAGTTGGAAGG + Intergenic
1143653342 17:8278020-8278042 ACATGGACTCTTAAGAGGGATGG + Intergenic
1146385728 17:32371296-32371318 ACATGAAGTCTGAAGTTGTATGG + Exonic
1148758322 17:49986205-49986227 ATATGGAGGCTGAAGTGGGTGGG + Intergenic
1152697973 17:81805763-81805785 ACCTGGACTGTGAAGGTGGAGGG + Intronic
1156408769 18:36807846-36807868 ACATGGAGTGTGAAGCTGGATGG - Exonic
1157021449 18:43787754-43787776 ACTTGGAGTCTGAAGTTTGAGGG + Intergenic
1159858180 18:73614489-73614511 GAATGGATGCTGAAGTTGAAGGG + Intergenic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1166117853 19:40666929-40666951 ACATGGGCCCCAAAGTTGGAGGG + Exonic
1167261305 19:48460173-48460195 GCATGGACCCTGGAGCTGGATGG + Intronic
926502072 2:13668089-13668111 AAATGGAGGCAGAAATTGGAGGG + Intergenic
928305679 2:30168505-30168527 ACATGGATGATGAAGCTGAAGGG + Intergenic
931199258 2:60081175-60081197 ACATGGCTGCAGTAGTTGGAGGG + Intergenic
932140274 2:69270819-69270841 ACATGGATGATGAAGTGTGAAGG - Intergenic
932702046 2:73998768-73998790 ACATAGGCTCTGAAGGTGGAGGG + Intronic
933150245 2:78905932-78905954 ACAAGCAATCTGAAGTTGGAAGG + Intergenic
934475780 2:94592470-94592492 GCATGGGAGCTGGAGTTGGATGG - Intronic
936478581 2:112864160-112864182 ACTTGGAGGCTGATGTTCGAGGG + Intergenic
936607697 2:113974692-113974714 AAAGGAAGGCTGAAGTTGGAAGG - Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
939805792 2:146774919-146774941 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
939806553 2:146781074-146781096 ACTTGGAATCTGATGTTGGAGGG - Intergenic
943057820 2:183005315-183005337 ACTAGGACACTGAAGTTGGAAGG - Intronic
943299035 2:186174124-186174146 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
943636265 2:190310109-190310131 ACTTGGAAGCTGATGTTTGAAGG - Intronic
944709382 2:202322119-202322141 ACTAGGACTCTGAAGTTGCATGG - Intergenic
946569723 2:221010418-221010440 ACATGGAGTCTGATGTTGGAGGG - Intergenic
946599427 2:221343330-221343352 ACCTGGAGTCTGATGTTGGAGGG + Intergenic
946691442 2:222311667-222311689 ACCTGGACACGAAAGTTGGAGGG - Intergenic
1169478009 20:5950003-5950025 AAAAGGATGCTGAAGGTGGACGG + Intronic
1173334823 20:42104000-42104022 ACATAGCCACTGAAGTTGGTTGG + Intronic
1174534532 20:51240622-51240644 ACATGGAGCCTGAAGTTTGGGGG - Intergenic
1176997728 21:15576779-15576801 ACTTGGAGGCTGATGTTTGAGGG - Intergenic
1177268038 21:18809562-18809584 ACATGGAGCCTGATGTTTGAGGG - Intergenic
1177296848 21:19187044-19187066 ACTTGGAGGCTGATGTTTGAGGG + Intergenic
1178011479 21:28291362-28291384 ACATGGAGTCTGATGTTCGAGGG + Intergenic
1178173463 21:30069537-30069559 CCATGGAAGATGAAATTGGAGGG + Intergenic
1178751263 21:35305651-35305673 ACAGGGACGCTGGGGCTGGAGGG + Intronic
1181508636 22:23378896-23378918 ACATGGCAGGTCAAGTTGGATGG + Intergenic
1182806775 22:33078998-33079020 GCATGGATGCTGGAGCTGGATGG + Intergenic
1183952080 22:41357706-41357728 AGCTGGAGGCTGAAGCTGGAGGG - Exonic
1184226983 22:43134770-43134792 ACATGGAGGGTGATGGTGGAGGG - Intronic
1184735683 22:46396560-46396582 ACATGGACTCTGAAGGTGCAGGG + Intronic
950189161 3:10964717-10964739 TCATGGATGCGGAAGTTGGCGGG - Intergenic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
954389142 3:50259907-50259929 TCATTGACTCTGAAGATGGAAGG + Intergenic
954809904 3:53241340-53241362 AAATGGATGCTGCAGTTGGCCGG - Intronic
954873526 3:53785563-53785585 ACATGGATCCTGAAGCTTGATGG - Intronic
954958434 3:54542583-54542605 ACATGGAGTCTGATGTTGGAGGG + Intronic
956784557 3:72631634-72631656 AGATGGAGGCTGCATTTGGATGG - Intergenic
958617346 3:96512097-96512119 ACTTGGAGACTGATGTTGGAGGG - Intergenic
958776339 3:98487448-98487470 ACCTGGAGCCTGAAGTTGCAGGG - Intergenic
959295581 3:104530794-104530816 CCATGGACACTGGAGTTGGCAGG + Intergenic
961733412 3:128984461-128984483 ACTTGGAGGCTGATGTTTGAGGG - Intronic
962075796 3:132080635-132080657 ACTTGGAGTCTGATGTTGGAGGG - Intronic
962224582 3:133595029-133595051 AAGTGGATACTGAAGTTGGAGGG + Intergenic
962347091 3:134626202-134626224 ACATGGAGGCTGAAGGTGGGTGG - Intronic
964699244 3:159545445-159545467 ACATGGAGTCTGATGTTTGAGGG - Intronic
965693651 3:171383939-171383961 AAAGGGAGGCTGAGGTTGGATGG - Intronic
967234214 3:187368511-187368533 ACATGGACGCTGAAGTTGGATGG + Exonic
968506180 4:972474-972496 CCAGGGACGCTGAGGTGGGAGGG - Intronic
969295801 4:6270153-6270175 ACAAGGTCCCCGAAGTTGGAGGG + Intronic
969380524 4:6793927-6793949 ACATGAACTTTTAAGTTGGAAGG - Intronic
971580413 4:28331566-28331588 AGATGGAGGCAGAGGTTGGAGGG + Intergenic
972369661 4:38410709-38410731 AAATGGCCGATGAAGGTGGATGG + Intergenic
972597190 4:40540129-40540151 ACATGGCACCTGAAGTTAGATGG - Intronic
974012285 4:56617888-56617910 AGAAGGACGCAGAATTTGGACGG - Intergenic
976011038 4:80488847-80488869 GCATGGAATCTGGAGTTGGATGG + Intronic
976291464 4:83422527-83422549 AGATGGAGGCTGAGATTGGAGGG + Intronic
977577968 4:98694802-98694824 ACATGCAAGTTGAAGTTGTATGG - Intergenic
978079378 4:104573494-104573516 ACTTGGAGTCTGATGTTGGAGGG + Intergenic
978160613 4:105542990-105543012 ACATGGACACTGGAACTGGAAGG - Intergenic
980188618 4:129494760-129494782 ACTTGGAGTCTGATGTTGGAGGG - Intergenic
980628244 4:135404209-135404231 ACATGGAGTCTGATGTTCGAGGG - Intergenic
981247811 4:142560635-142560657 ACATGGATTCTGATGTTCGAGGG + Intronic
981283475 4:142988333-142988355 ACACAGAGGCTGAAATTGGAAGG - Intergenic
982904501 4:161050465-161050487 ACATGGAGTCTGATGTTCGAGGG + Intergenic
986098905 5:4587117-4587139 ACATGGAGTCTGATGTTTGAAGG - Intergenic
986133768 5:4955353-4955375 ACATGGAGTCTGATGTTTGAGGG + Intergenic
986147311 5:5090643-5090665 ACATGGAGTCTGATGTTCGAGGG + Intergenic
988229081 5:28450740-28450762 ACATGGAGTCTGATGTTCGAGGG - Intergenic
988314182 5:29602706-29602728 ACCTGGAGTCTGAAGTTTGAGGG + Intergenic
988995630 5:36712382-36712404 ACATGGACTGTGGATTTGGATGG - Intergenic
991222063 5:64228021-64228043 ACATGGAGGCTGATATTGTAAGG - Intronic
994373948 5:98997101-98997123 ACTGGGAGGCTGAAGTCGGATGG - Intergenic
994984837 5:106919139-106919161 ACTTGGAGTCTGAAGTTCGAGGG + Intergenic
996322544 5:122235275-122235297 ACTTGGAGTCTGATGTTGGAGGG + Intergenic
997715674 5:136040880-136040902 ACATAGATGCTGTGGTTGGATGG - Intronic
1001241692 5:170076144-170076166 TGCTGGAGGCTGAAGTTGGAGGG + Intronic
1001419795 5:171578017-171578039 ACATGCACCCTGGAGTCGGAGGG - Intergenic
1002172095 5:177380922-177380944 ACTTGGAGGCTGAGGTGGGAGGG - Intronic
1003039230 6:2671509-2671531 AGATGGACTCTGAGGTTGGCCGG - Intronic
1006825350 6:36930719-36930741 ACATGGATGGTGAATTGGGATGG - Intergenic
1008187436 6:48411570-48411592 ACTTGGAGTCTGAAGTAGGAGGG + Intergenic
1009631052 6:66201660-66201682 ACATGGAGTCTGATGTTTGAAGG + Intergenic
1012900815 6:105004050-105004072 ACATGGAGTCTGATGTTCGAAGG + Intronic
1015183805 6:130390760-130390782 ACATGGAAGCTGACTTTAGAAGG - Intronic
1017025724 6:150178904-150178926 ACATGGATGCTGGAGGTGAAGGG + Intronic
1017870687 6:158484024-158484046 ACTTGGAGGCTGAAGTGGGAGGG - Intronic
1018545500 6:164932533-164932555 ACTTGGAGTCTGACGTTGGAGGG + Intergenic
1021269668 7:18570590-18570612 TCATGGACTCTGGAGCTGGACGG + Intronic
1022135061 7:27439408-27439430 ACATGGAGGTTGGAGTGGGAGGG - Intergenic
1023743430 7:43301318-43301340 ACATGGAAGCTGGACCTGGAAGG - Intronic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1026033038 7:66811731-66811753 ACATGAACTCTGAAGCTGGAAGG + Intergenic
1033884734 7:145931572-145931594 AAAAGGACACTGAAGGTGGAAGG + Intergenic
1034278463 7:149835021-149835043 ACATGGACACTGAAAATGGGTGG - Intergenic
1034871478 7:154688625-154688647 ACTTGGAGTCTGATGTTGGAGGG + Intronic
1037605143 8:20431927-20431949 ACATGTAGGATGAATTTGGAAGG - Intergenic
1038036736 8:23692440-23692462 GCAGGGAGGCTGAAGTGGGAGGG + Intergenic
1038977994 8:32723249-32723271 AAATGAACACTGAAGTTGGCTGG - Intronic
1039649083 8:39321121-39321143 ACATGGAAGATAAAGCTGGAGGG + Intergenic
1041870920 8:62633712-62633734 ATAAGGTGGCTGAAGTTGGAGGG - Intronic
1043789751 8:84449444-84449466 ACAGGGACACTTAAGGTGGAAGG - Intronic
1044473575 8:92600578-92600600 AGATGGAGGCAGAGGTTGGAGGG + Intergenic
1047027301 8:120837834-120837856 ACATGGAAGCTGATTTTGCAGGG + Intergenic
1047550923 8:125871447-125871469 ACATGGAGTCTGATGTTTGAGGG + Intergenic
1048287006 8:133149809-133149831 AGATGGAAACTGAAGTTTGAAGG + Intergenic
1049538840 8:143196632-143196654 ACCTGGAGTCTGATGTTGGAGGG - Intergenic
1049737168 8:144214909-144214931 ACCTGGAGTCTGATGTTGGAGGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051639820 9:19214232-19214254 ACATGGAGGCTGAAGATTGTTGG + Intergenic
1051788435 9:20772211-20772233 AAATGGTAGCTGATGTTGGAGGG + Intronic
1052854274 9:33397447-33397469 GCATGGGAGCTGGAGTTGGATGG + Intronic
1053682285 9:40493608-40493630 GCATGGGAGCTGGAGTTGGATGG + Intergenic
1053932266 9:43121935-43121957 ACATGGGAGCTGGAGTTGGATGG + Intergenic
1054281429 9:63131321-63131343 GCATGGGAGCTGGAGTTGGATGG - Intergenic
1054295384 9:63329108-63329130 GCATGGGAGCTGGAGTTGGATGG + Intergenic
1054393401 9:64633612-64633634 GCATGGGAGCTGGAGTTGGATGG + Intergenic
1054428051 9:65138826-65138848 GCATGGGAGCTGGAGTTGGATGG + Intergenic
1054502328 9:65882718-65882740 GCATGGGAGCTGGAGTTGGATGG - Intronic
1055610487 9:78019392-78019414 ACATGGAGTCTGGAGGTGGAAGG - Intronic
1058055846 9:100448081-100448103 AGTTGGAGGCTGAAGTGGGAGGG + Intronic
1059171135 9:112126250-112126272 TCATGTACACTGAAGGTGGAAGG + Intronic
1059196615 9:112376644-112376666 ACCTGGAGTCTGATGTTGGAGGG + Intergenic
1059311671 9:113392431-113392453 ACTTGGACTCTGAATTTGGCAGG + Intronic
1059499196 9:114736613-114736635 GCATAGACTCTGAAGTTGGGTGG + Intergenic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1060665930 9:125432165-125432187 ACAGGGGCGCTGCAGTTGCACGG - Intergenic
1190304261 X:49073352-49073374 AAATAGACGGTAAAGTTGGAGGG - Intronic
1190823225 X:53993789-53993811 ACATGGACACTGAAGTGGAATGG + Exonic
1191050146 X:56183003-56183025 ACATGGACGTTTAAGTCTGAAGG + Intergenic
1194465863 X:94234856-94234878 TCATGGACACTGGAGTTGGCTGG + Intergenic
1194526063 X:94978494-94978516 CCATGGACGCTTGAGTTGGCAGG - Intergenic
1195548300 X:106138334-106138356 CCATGGACACTTGAGTTGGAAGG + Intergenic
1198302351 X:135344694-135344716 ACAGGGATGCTGACGTGGGAGGG - Intergenic
1198782716 X:140255183-140255205 ACTTGGAGTCTGATGTTGGAGGG + Intergenic
1199046694 X:143182656-143182678 ACTTGGAGTCTGATGTTGGAGGG - Intergenic