ID: 967234414

View in Genome Browser
Species Human (GRCh38)
Location 3:187370328-187370350
Sequence AAGGATACGCAACCTGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967234414_967234417 9 Left 967234414 3:187370328-187370350 CCTTAAGCAGGTTGCGTATCCTT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 967234417 3:187370360-187370382 CAGTTTCCTTATCTGGATATTGG 0: 1
1: 1
2: 66
3: 727
4: 4098
967234414_967234418 10 Left 967234414 3:187370328-187370350 CCTTAAGCAGGTTGCGTATCCTT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 967234418 3:187370361-187370383 AGTTTCCTTATCTGGATATTGGG 0: 1
1: 0
2: 34
3: 536
4: 3406
967234414_967234416 2 Left 967234414 3:187370328-187370350 CCTTAAGCAGGTTGCGTATCCTT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 967234416 3:187370353-187370375 CATGATTCAGTTTCCTTATCTGG 0: 1
1: 0
2: 3
3: 35
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967234414 Original CRISPR AAGGATACGCAACCTGCTTA AGG (reversed) Intronic
902429308 1:16350848-16350870 TAAGATACGCAACATGCCTATGG + Intronic
905257770 1:36696134-36696156 GAGGTTAAGCAACCTGCCTAAGG + Intergenic
907725521 1:57016926-57016948 AAGGAAAAGCAACTTGCTCAGGG + Intronic
908056860 1:60297190-60297212 AAGGATACGAAACCAGCATGTGG + Intergenic
908741833 1:67336832-67336854 AAGGTTAAGGAACTTGCTTAAGG - Intronic
913253374 1:116931052-116931074 AAGGATGCTCAACCTGTATAAGG - Intronic
915003833 1:152618673-152618695 AAGGATGGGCAAGCTCCTTATGG + Intergenic
915042386 1:152980120-152980142 AAGGTTAGGCAACTTGCTCAAGG + Intergenic
916446080 1:164873096-164873118 AAGGATACACAACCAGTATATGG + Intronic
917047434 1:170877088-170877110 AAGGATGCACAACCTGTATAAGG - Intergenic
917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG + Intronic
1063778089 10:9287605-9287627 AAGGAAACTCAACCTGGTTTGGG + Intergenic
1065201968 10:23321581-23321603 AAGGTTAAGTAACTTGCTTAAGG - Intronic
1066354589 10:34670097-34670119 ACGGATAAGCCACCTGCTTTGGG - Intronic
1069625316 10:69864155-69864177 GAGGTTAAGCAACCTGCCTAAGG - Intronic
1070484462 10:76916164-76916186 ATGTATATGCCACCTGCTTATGG + Intronic
1073274594 10:102299083-102299105 AAGGTTATGCAACCTGCCCAAGG - Intronic
1079443145 11:20535180-20535202 AGGCATAAGCAGCCTGCTTAAGG - Intergenic
1080329768 11:31122455-31122477 AATGTTTAGCAACCTGCTTAAGG + Intronic
1080395007 11:31882094-31882116 AAGAACAAGTAACCTGCTTAAGG - Intronic
1080907917 11:36565349-36565371 AAGTGTAGGCAACCTGCTCAGGG + Intronic
1081192215 11:40117783-40117805 AAGGATAAGTAACTTGCTCAAGG - Intronic
1083796732 11:65021329-65021351 GAGGTTAAGCAACCTGCCTAGGG - Intronic
1085318664 11:75561539-75561561 AAGGGAAAGTAACCTGCTTAGGG + Intergenic
1087150095 11:94851640-94851662 AAGGTTACGTGACTTGCTTAAGG - Intronic
1088506134 11:110529338-110529360 AAGGTTAAACAACCTGCTCAAGG - Intergenic
1091227356 11:133965516-133965538 GAGGTTACGCAACTTGCTTAAGG - Intergenic
1092681526 12:10987873-10987895 ACAGATAATCAACCTGCTTATGG - Intronic
1095248609 12:39952140-39952162 AAGGTTAGTCAACCTACTTAAGG - Intronic
1096065731 12:48738486-48738508 AAGAATACTCAAACAGCTTATGG - Intergenic
1097193884 12:57233336-57233358 CAGGATCCCCAACCTGCTTTAGG - Exonic
1101091270 12:101288379-101288401 AAGCATAAGCAACTTGCTCAAGG - Intronic
1102378375 12:112442258-112442280 AGGGATACTCAACCTGTATAAGG - Intronic
1104358195 12:128107130-128107152 AAGGATACTCAACCAGCAAATGG + Intergenic
1109311956 13:60705573-60705595 AAGGAAAGGCAACATTCTTAGGG + Intergenic
1110295781 13:73863390-73863412 AAGGATAAGAAATTTGCTTATGG - Intronic
1112374813 13:98829462-98829484 AAGGATACGCACGGTGCTAATGG - Exonic
1115993303 14:39171347-39171369 CAGGCTAAGCAACATGCTTACGG - Intergenic
1116598099 14:46879926-46879948 AAGTATACGTTTCCTGCTTAAGG - Intronic
1117761138 14:59029968-59029990 AAGGTTAAGCAACTTGCTGAAGG + Intergenic
1118076432 14:62304443-62304465 AAGGAAAAGCATCCTGCTTAAGG - Intergenic
1119570653 14:75668348-75668370 AAGGTTAAGTAACCTGCCTAAGG - Intronic
1119919890 14:78437006-78437028 AAGGATAAGCAACTTGCTGAAGG - Intronic
1120208367 14:81610057-81610079 AAGGATAAGTAACCTGCCCAAGG - Intergenic
1124055338 15:26236734-26236756 AGGGATACTCAACCTGCATTAGG + Intergenic
1128796293 15:70469175-70469197 AAGGAGAGGCAACATGTTTAGGG + Intergenic
1128885454 15:71282800-71282822 AAGGATACGCAAGTTGAATAAGG - Intronic
1132037941 15:98502107-98502129 AAGGTTAAGAAACCTGCTCAAGG + Intronic
1133967144 16:10539672-10539694 AAGGAAACGCAGGCTTCTTAAGG - Intronic
1135909898 16:26550403-26550425 AAGGCTAAGCAACTTGCTCACGG - Intergenic
1138175580 16:54895454-54895476 AAAGAAACTCAACCTGCTGAAGG + Intergenic
1139568175 16:67792960-67792982 AAGGATGTGTAACCTGCCTAGGG - Intronic
1144175685 17:12704700-12704722 GAGGTTAAGCAACTTGCTTAGGG + Intronic
1144747537 17:17625876-17625898 AAGGATTTGAAACCTGATTAGGG - Intergenic
1147315815 17:39619629-39619651 AAGGTTAAGCAACCTGCTCAAGG + Intergenic
1154013369 18:10594555-10594577 AAGGAGAAGTAACCTGCCTAAGG + Intergenic
1154152542 18:11917818-11917840 AAGGAGAAGTAACCTGCCTAAGG + Intergenic
1155384319 18:25260453-25260475 AAGGTTAAGTAACTTGCTTAAGG - Intronic
1158525363 18:58208367-58208389 AAGGAGGCTCAACCTACTTATGG - Intronic
925540214 2:4958716-4958738 AAGGCTAAGTAACTTGCTTAAGG + Intergenic
927451913 2:23216053-23216075 AAGGATGCCCAAGCAGCTTATGG + Intergenic
928642779 2:33318195-33318217 AGGGATACTCAACCTGTATATGG + Intronic
929910693 2:46087060-46087082 AAGGATACTCAAGTTCCTTAAGG + Intronic
930845033 2:55894832-55894854 AAGGAAAAGCACCATGCTTATGG + Intronic
931172013 2:59813608-59813630 AAGAATACGCACCTTTCTTAAGG - Intergenic
942311395 2:174660313-174660335 AAATTTAGGCAACCTGCTTAGGG - Intronic
946281305 2:218667585-218667607 AAAGATACGCATCTTGCTTGGGG - Intronic
946527046 2:220531886-220531908 AAGGATACTCAACCTGCATAAGG + Intergenic
1173201409 20:40957788-40957810 AAGGAAACTCAACCTTCCTAGGG - Intergenic
1173353804 20:42268691-42268713 AAGGCTATGCAACTTGCTTAAGG + Intronic
1174298468 20:49565715-49565737 AAGGCTAAGCAACTTGCTCAAGG - Intronic
1175789883 20:61734633-61734655 AGGGAAACTCAACCTGCTGAAGG - Intronic
1178724348 21:35037653-35037675 AAGGTTACGTGACCTGCTTGTGG - Intronic
1182910561 22:33980784-33980806 CAGGATACGCGGCCTGCTTAAGG - Intergenic
955130968 3:56168152-56168174 GAGGATAAGCAACCTGCCCATGG - Intronic
957220533 3:77376614-77376636 AAGGATATGCAACCAACCTAGGG - Intronic
966635057 3:182123823-182123845 AAGGATAAGCAACTTGCCCAAGG + Intergenic
967132321 3:186483676-186483698 AAGCATTCGCAACCTGCTACAGG + Intergenic
967234414 3:187370328-187370350 AAGGATACGCAACCTGCTTAAGG - Intronic
970653605 4:18205333-18205355 AAGGTTAAGTAACTTGCTTAAGG - Intergenic
977569937 4:98618604-98618626 AAGGATAAGTAACTTGCCTAGGG + Intronic
978277425 4:106968376-106968398 CAGGATAATCAACTTGCTTAAGG + Intronic
979068230 4:116166617-116166639 AAGGATCAGGGACCTGCTTAAGG + Intergenic
990765452 5:59177567-59177589 AAGGGTATGCAACCTGCCCAGGG + Intronic
994332479 5:98523349-98523371 AAGGAGAAGCCACCAGCTTAGGG - Intergenic
994988005 5:106962564-106962586 AAGGGGTCGCCACCTGCTTAGGG + Intergenic
997957053 5:138286987-138287009 AAGGGAAAGTAACCTGCTTAAGG + Intronic
998561396 5:143175306-143175328 AAGCATAAGCAAAATGCTTAGGG + Intronic
998662865 5:144260000-144260022 GATGAAATGCAACCTGCTTAGGG - Intronic
998785889 5:145708349-145708371 GAGGTTAAGCAACTTGCTTAAGG - Intronic
998928463 5:147154267-147154289 AAGGTTATGTAACTTGCTTAAGG - Intergenic
999360784 5:150984928-150984950 AAGTATACACAGCCTACTTATGG - Intergenic
1000523397 5:162325691-162325713 AAGGCTAAGTAACTTGCTTATGG - Intergenic
1001378303 5:171283712-171283734 ATGGATATGCACACTGCTTAGGG - Intronic
1001468920 5:171994584-171994606 AGGGATACTCAACCTGTATAAGG + Intronic
1001480316 5:172084698-172084720 AAGGATACTCTACCTGTATAAGG - Intronic
1004571257 6:16847749-16847771 AATGAAAGGCAACCTGCTGAAGG - Intergenic
1006988907 6:38196228-38196250 GAGGCTAAGCAACTTGCTTAAGG - Intronic
1014415444 6:121177860-121177882 AAGGATACTCAACTTGCATTAGG + Intronic
1015195691 6:130522830-130522852 AAGGATATGCAACTTGCCCAGGG + Intergenic
1023387670 7:39676392-39676414 AAGGATACATAACCTGTTTTAGG - Intronic
1023474926 7:40566713-40566735 AAGCATCCACAACCTGCTCACGG - Intronic
1028777112 7:94689905-94689927 AAGTATAGGCAACCTTCTGATGG - Intergenic
1038022389 8:23561538-23561560 AAGGTTAAGGAACCTGCTTGAGG + Intronic
1038282043 8:26174580-26174602 AAGGATCTGCATCCTCCTTATGG + Intergenic
1038913948 8:31998994-31999016 AAGTATACCCAACCTGCTTTGGG - Intronic
1039017876 8:33172712-33172734 AAGGATGTGCAAACTCCTTACGG + Intergenic
1039374334 8:37018270-37018292 AAGGGTACTCAACCTGTATATGG + Intergenic
1054928670 9:70614136-70614158 AAGGATACCCAGCCTGTTCATGG - Intronic
1055907844 9:81314598-81314620 AGGGATACACAGCCTGCTTGTGG + Intergenic
1057805272 9:98215450-98215472 AAGGGTAGGCAACTTGCCTAAGG + Intronic
1058676882 9:107407683-107407705 AAGGATACTCACTCGGCTTAAGG + Intergenic
1062351733 9:136142917-136142939 AAGCATACCCCACCTGCTCAGGG + Intergenic
1188004574 X:25008202-25008224 AGGGATACACAACCTGCTCTTGG + Intronic
1190636549 X:52440440-52440462 AAGGATATGCAATTTGGTTAAGG - Intergenic
1190714280 X:53090867-53090889 CAGGAGAAGCAACCTGCCTAAGG + Intergenic
1198484077 X:137068889-137068911 AAGAAAATGCAACCTGTTTAAGG + Intergenic
1198506003 X:137302130-137302152 AAGAATAAGCCACCTGCTCATGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic