ID: 967236887

View in Genome Browser
Species Human (GRCh38)
Location 3:187393683-187393705
Sequence GAGCAACACCACAATTAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967236887_967236891 9 Left 967236887 3:187393683-187393705 CCCATCTAATTGTGGTGTTGCTC No data
Right 967236891 3:187393715-187393737 ACCCCAAGAAGGTTGTATAGCGG No data
967236887_967236889 -2 Left 967236887 3:187393683-187393705 CCCATCTAATTGTGGTGTTGCTC No data
Right 967236889 3:187393704-187393726 TCATTCGTGCCACCCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967236887 Original CRISPR GAGCAACACCACAATTAGAT GGG (reversed) Intergenic
No off target data available for this crispr