ID: 967240207

View in Genome Browser
Species Human (GRCh38)
Location 3:187431127-187431149
Sequence TTGGGTTTACAGAGAGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967240207_967240212 6 Left 967240207 3:187431127-187431149 CCTTGCCCTCTCTGTAAACCCAA No data
Right 967240212 3:187431156-187431178 TGAGATCACCTTCAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967240207 Original CRISPR TTGGGTTTACAGAGAGGGCA AGG (reversed) Intergenic
No off target data available for this crispr