ID: 967241032

View in Genome Browser
Species Human (GRCh38)
Location 3:187439725-187439747
Sequence CCAGTGGTGGAAGGGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967241026_967241032 -7 Left 967241026 3:187439709-187439731 CCAGGTAAGAGACAAGCCAGTGG No data
Right 967241032 3:187439725-187439747 CCAGTGGTGGAAGGGTTGTCAGG No data
967241025_967241032 9 Left 967241025 3:187439693-187439715 CCAGGAAGCAGGAGGACCAGGTA No data
Right 967241032 3:187439725-187439747 CCAGTGGTGGAAGGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967241032 Original CRISPR CCAGTGGTGGAAGGGTTGTC AGG Intergenic
No off target data available for this crispr