ID: 967241500

View in Genome Browser
Species Human (GRCh38)
Location 3:187444220-187444242
Sequence CAGAACCTAAGTGGGAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967241500_967241507 29 Left 967241500 3:187444220-187444242 CCTCTATTCCCACTTAGGTTCTG No data
Right 967241507 3:187444272-187444294 CAGAGGTGCCAAAGACCACAGGG No data
967241500_967241506 28 Left 967241500 3:187444220-187444242 CCTCTATTCCCACTTAGGTTCTG No data
Right 967241506 3:187444271-187444293 CCAGAGGTGCCAAAGACCACAGG No data
967241500_967241503 12 Left 967241500 3:187444220-187444242 CCTCTATTCCCACTTAGGTTCTG No data
Right 967241503 3:187444255-187444277 CTCTTGTCTGTTTTTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967241500 Original CRISPR CAGAACCTAAGTGGGAATAG AGG (reversed) Intergenic
No off target data available for this crispr