ID: 967248177

View in Genome Browser
Species Human (GRCh38)
Location 3:187509768-187509790
Sequence CAATCTGCACTGATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967248177_967248183 20 Left 967248177 3:187509768-187509790 CCCAGCTGCATCAGTGCAGATTG No data
Right 967248183 3:187509811-187509833 CCACAGAAGACAGCTTTGCAGGG No data
967248177_967248181 19 Left 967248177 3:187509768-187509790 CCCAGCTGCATCAGTGCAGATTG No data
Right 967248181 3:187509810-187509832 ACCACAGAAGACAGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967248177 Original CRISPR CAATCTGCACTGATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr