ID: 967248177 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:187509768-187509790 |
| Sequence | CAATCTGCACTGATGCAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967248177_967248183 | 20 | Left | 967248177 | 3:187509768-187509790 | CCCAGCTGCATCAGTGCAGATTG | No data | ||
| Right | 967248183 | 3:187509811-187509833 | CCACAGAAGACAGCTTTGCAGGG | No data | ||||
| 967248177_967248181 | 19 | Left | 967248177 | 3:187509768-187509790 | CCCAGCTGCATCAGTGCAGATTG | No data | ||
| Right | 967248181 | 3:187509810-187509832 | ACCACAGAAGACAGCTTTGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967248177 | Original CRISPR | CAATCTGCACTGATGCAGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||