ID: 967255946

View in Genome Browser
Species Human (GRCh38)
Location 3:187591877-187591899
Sequence TGGATTTCCCTTAAAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967255946_967255947 -9 Left 967255946 3:187591877-187591899 CCAGTATTTTTAAGGGAAATCCA No data
Right 967255947 3:187591891-187591913 GGAAATCCAGACTAGTTTTAAGG No data
967255946_967255949 20 Left 967255946 3:187591877-187591899 CCAGTATTTTTAAGGGAAATCCA No data
Right 967255949 3:187591920-187591942 TTAAAACTCTCATGCTTTCCAGG No data
967255946_967255950 21 Left 967255946 3:187591877-187591899 CCAGTATTTTTAAGGGAAATCCA No data
Right 967255950 3:187591921-187591943 TAAAACTCTCATGCTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967255946 Original CRISPR TGGATTTCCCTTAAAAATAC TGG (reversed) Intergenic
No off target data available for this crispr