ID: 967258992

View in Genome Browser
Species Human (GRCh38)
Location 3:187623446-187623468
Sequence TATTCTTTTATTCCCTCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967258992_967258998 20 Left 967258992 3:187623446-187623468 CCTTTTGAGGGAATAAAAGAATA No data
Right 967258998 3:187623489-187623511 CCACAGCCTTGAGGAGCAGGAGG No data
967258992_967258993 11 Left 967258992 3:187623446-187623468 CCTTTTGAGGGAATAAAAGAATA No data
Right 967258993 3:187623480-187623502 CGATTCTCCCCACAGCCTTGAGG No data
967258992_967258994 17 Left 967258992 3:187623446-187623468 CCTTTTGAGGGAATAAAAGAATA No data
Right 967258994 3:187623486-187623508 TCCCCACAGCCTTGAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967258992 Original CRISPR TATTCTTTTATTCCCTCAAA AGG (reversed) Intergenic