ID: 967258993

View in Genome Browser
Species Human (GRCh38)
Location 3:187623480-187623502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967258992_967258993 11 Left 967258992 3:187623446-187623468 CCTTTTGAGGGAATAAAAGAATA No data
Right 967258993 3:187623480-187623502 CGATTCTCCCCACAGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type