ID: 967258998 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:187623489-187623511 |
| Sequence | CCACAGCCTTGAGGAGCAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 967258992_967258998 | 20 | Left | 967258992 | 3:187623446-187623468 | CCTTTTGAGGGAATAAAAGAATA | No data | ||
| Right | 967258998 | 3:187623489-187623511 | CCACAGCCTTGAGGAGCAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 967258998 | Original CRISPR | CCACAGCCTTGAGGAGCAGG AGG | Intergenic | ||