ID: 967260174

View in Genome Browser
Species Human (GRCh38)
Location 3:187634253-187634275
Sequence TGCACGGGTGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967260174_967260181 20 Left 967260174 3:187634253-187634275 CCTTGGGCAGCTCCACCCGTGCA No data
Right 967260181 3:187634296-187634318 TGCAGCTGCTCTCAAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967260174 Original CRISPR TGCACGGGTGGAGCTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr