ID: 967261284

View in Genome Browser
Species Human (GRCh38)
Location 3:187645122-187645144
Sequence ATTTAAGGTGGCTTGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967261284_967261293 7 Left 967261284 3:187645122-187645144 CCTGCTGCCAAGCCACCTTAAAT No data
Right 967261293 3:187645152-187645174 ATGAATGCTAGGCTGGGCTTTGG No data
967261284_967261290 0 Left 967261284 3:187645122-187645144 CCTGCTGCCAAGCCACCTTAAAT No data
Right 967261290 3:187645145-187645167 CCAACCAATGAATGCTAGGCTGG No data
967261284_967261291 1 Left 967261284 3:187645122-187645144 CCTGCTGCCAAGCCACCTTAAAT No data
Right 967261291 3:187645146-187645168 CAACCAATGAATGCTAGGCTGGG No data
967261284_967261288 -4 Left 967261284 3:187645122-187645144 CCTGCTGCCAAGCCACCTTAAAT No data
Right 967261288 3:187645141-187645163 AAATCCAACCAATGAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967261284 Original CRISPR ATTTAAGGTGGCTTGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr