ID: 967264239

View in Genome Browser
Species Human (GRCh38)
Location 3:187676091-187676113
Sequence CGGCATGTGCAAATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967264239_967264243 -10 Left 967264239 3:187676091-187676113 CCCACCTCCATTTGCACATGCCG No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967264239 Original CRISPR CGGCATGTGCAAATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr