ID: 967264243

View in Genome Browser
Species Human (GRCh38)
Location 3:187676104-187676126
Sequence GCACATGCCGTTTCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967264239_967264243 -10 Left 967264239 3:187676091-187676113 CCCACCTCCATTTGCACATGCCG No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264238_967264243 -7 Left 967264238 3:187676088-187676110 CCTCCCACCTCCATTTGCACATG No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264236_967264243 0 Left 967264236 3:187676081-187676103 CCTGTACCCTCCCACCTCCATTT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264237_967264243 -6 Left 967264237 3:187676087-187676109 CCCTCCCACCTCCATTTGCACAT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264233_967264243 20 Left 967264233 3:187676061-187676083 CCTCTAACCACTCACTCTTCCCT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264230_967264243 30 Left 967264230 3:187676051-187676073 CCTCCTAATCCCTCTAACCACTC No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264231_967264243 27 Left 967264231 3:187676054-187676076 CCTAATCCCTCTAACCACTCACT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264235_967264243 1 Left 967264235 3:187676080-187676102 CCCTGTACCCTCCCACCTCCATT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264234_967264243 13 Left 967264234 3:187676068-187676090 CCACTCACTCTTCCCTGTACCCT No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data
967264232_967264243 21 Left 967264232 3:187676060-187676082 CCCTCTAACCACTCACTCTTCCC No data
Right 967264243 3:187676104-187676126 GCACATGCCGTTTCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967264243 Original CRISPR GCACATGCCGTTTCCTCTCC TGG Intergenic
No off target data available for this crispr