ID: 967267672

View in Genome Browser
Species Human (GRCh38)
Location 3:187705001-187705023
Sequence CATGCTTCCCAGCACCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967267668_967267672 0 Left 967267668 3:187704978-187705000 CCAAGGGCCCAAATTCTGTGCAC 0: 1
1: 0
2: 2
3: 16
4: 155
Right 967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 195
967267669_967267672 -7 Left 967267669 3:187704985-187705007 CCCAAATTCTGTGCACCATGCTT 0: 1
1: 0
2: 2
3: 14
4: 160
Right 967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 195
967267670_967267672 -8 Left 967267670 3:187704986-187705008 CCAAATTCTGTGCACCATGCTTC 0: 1
1: 0
2: 1
3: 12
4: 158
Right 967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG 0: 1
1: 0
2: 1
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967267672 Original CRISPR CATGCTTCCCAGCACCCCAA AGG Intronic
901248435 1:7752705-7752727 CATGGTTACCAGCACTCCAAGGG - Intronic
901900469 1:12357514-12357536 GATTCTTCCCACCATCCCAATGG + Intronic
902884160 1:19393061-19393083 CCTGCTCCCCAACTCCCCAAGGG + Intronic
903067592 1:20709475-20709497 CACGGGTCCCAGCATCCCAAGGG + Intronic
903252074 1:22061897-22061919 CATCCTCCCCATCACCCCTATGG + Intronic
904315781 1:29661600-29661622 CATGCTTCTCAGCTGCCCATGGG - Intergenic
904708917 1:32413748-32413770 CCTGCTTCCAACCACCCCAGTGG + Intergenic
906128229 1:43440655-43440677 CCTGCTTCCCAGTCCCCCATAGG + Intronic
906291565 1:44622766-44622788 CATGGCTCCAGGCACCCCAAAGG + Exonic
910276478 1:85454451-85454473 CATGATTCCCAGGACCCAACTGG + Intronic
911401916 1:97385929-97385951 CATGCTTCTCAGCAACCTACAGG - Intronic
917406181 1:174710896-174710918 CCTGCTCCACAGCACACCAATGG - Intronic
921432882 1:215083385-215083407 CATGCTTCCCAGCGCCTCGCGGG + Exonic
921602087 1:217116809-217116831 CATGCCTACCACCATCCCAATGG - Intronic
922230356 1:223680326-223680348 CATGTTACCAAGCACCCCAGGGG - Intergenic
1062871457 10:908448-908470 CATGCTTCCTAGGATCCCCATGG - Intronic
1063607693 10:7537323-7537345 CAAGCTTCACAGCAATCCAATGG + Intergenic
1064362536 10:14679010-14679032 CATCCTTTCCAGCACCCCTGTGG - Intronic
1066784921 10:38993056-38993078 CATTCTTCTCAGCACCACATCGG - Intergenic
1067374611 10:45716082-45716104 CATGCTTCCAATTCCCCCAAAGG + Intergenic
1067882421 10:50057720-50057742 CATGCTTCCAATTCCCCCAAAGG + Intergenic
1068044171 10:51864022-51864044 CATCCTTCCCAGCATCCCATTGG + Intronic
1071525871 10:86357917-86357939 CATGCCTACCTACACCCCAAGGG - Intronic
1072935670 10:99710692-99710714 CATTCATCCCAGGACCACAAGGG + Intronic
1075462002 10:122622738-122622760 CATCCTTCCCGTCGCCCCAAAGG - Intronic
1075780838 10:125016167-125016189 CACCCTTCCCAGTGCCCCAAGGG + Intronic
1076575471 10:131463997-131464019 CATGCATCCCATCACCCACACGG + Intergenic
1076765659 10:132631522-132631544 CATCCTGCACAGCACCCCAGTGG - Intronic
1077699966 11:4432143-4432165 CATGTTTCCCAGCACTGCCAGGG + Intergenic
1078429515 11:11277946-11277968 CATTCTTCTCAGCACCTCATCGG - Intronic
1078523985 11:12086673-12086695 CCTGCTTCCCATCTCTCCAAGGG + Intergenic
1079245054 11:18745741-18745763 AATTCTTCACAGCACCCCTATGG + Intronic
1080346603 11:31332826-31332848 CATTCTTCTCAGCACCACACTGG - Intronic
1081776886 11:45681750-45681772 CATGGATCCCAGCACCCCCATGG - Intergenic
1083334577 11:61915194-61915216 CATGCACCCCTGCACCCCCAGGG - Intronic
1085190674 11:74618694-74618716 CAGGTTTCCCAGCAGCCCAAAGG + Exonic
1088129561 11:106471433-106471455 CATCCTTCCCAGCTGCCAAATGG + Intergenic
1088297937 11:108321381-108321403 AATGCTTTCCAGCTCTCCAATGG - Exonic
1091809967 12:3389019-3389041 CCTGCTTGCCAGCACCACACTGG + Intronic
1092226478 12:6751638-6751660 CACCATTCCCAGCATCCCAAAGG + Exonic
1093377858 12:18453010-18453032 CATTCTTCTCAGCACCACATAGG - Intronic
1094270205 12:28605779-28605801 TAATCTTCCCAGCAGCCCAATGG - Intergenic
1096335398 12:50751494-50751516 CATGTTCCACAGCACCTCAAAGG - Intergenic
1098724638 12:73947471-73947493 TAAGCTTCCCAGCAGCCCACAGG + Intergenic
1099050017 12:77770678-77770700 CAGTTTTCCCAGCACCCAAATGG - Intergenic
1102351840 12:112198402-112198424 CCTGCTTCACAGAACCCCACAGG - Intronic
1102468587 12:113145601-113145623 CATGCTGCTCAGCAATCCAAAGG + Intergenic
1103392087 12:120581680-120581702 CAAGGTTCCCAGGGCCCCAAGGG - Intergenic
1103523201 12:121549820-121549842 CTTGCTTCCCTGCACCACCATGG + Intronic
1103798941 12:123524501-123524523 CATTATTCCCAGTACCCAAAAGG + Intronic
1103910552 12:124349803-124349825 CAGGCTTCCCGCCACCCCCAGGG + Intronic
1104982808 12:132581762-132581784 CAGGCTGCCCAGGCCCCCAAAGG - Exonic
1106777147 13:33019534-33019556 CAAGCTTCCCATCATCCCAGGGG - Intronic
1113432280 13:110261482-110261504 GTGGCTTCCCAGCAGCCCAAGGG + Intronic
1113484380 13:110643548-110643570 CCAGCTGCCCAGCACCCCGAGGG - Intronic
1114817926 14:25981869-25981891 CATTCTTCTCAGCACCATAATGG + Intergenic
1114869846 14:26643250-26643272 CATTCTTCTCAGCACCACATCGG - Intergenic
1115869490 14:37784076-37784098 CATTCTTCTCAGCACCACATCGG - Intronic
1116087297 14:40256281-40256303 CATACTTCCCACCTCCTCAAAGG - Intergenic
1118412807 14:65500317-65500339 GATGATGCCCAGAACCCCAAAGG - Intronic
1120316944 14:82906338-82906360 ATTCCTTCCCAGCATCCCAAGGG - Intergenic
1120484709 14:85098629-85098651 CAGGCTTTCCATCACCCCCAGGG + Intergenic
1121115674 14:91341178-91341200 CATGATTCAGAGCACCCTAAGGG + Intronic
1122284997 14:100645722-100645744 CAGCCTCCCCAGCACCCTAAAGG - Intergenic
1122490067 14:102109082-102109104 CAGACTTTCCAGCACCCCAGAGG + Intronic
1122689452 14:103524869-103524891 CCTGCTTCCCAGGTCCCCCATGG + Intergenic
1123921014 15:25069774-25069796 TATGTTTCCCAACACCACAAGGG - Intergenic
1128154200 15:65382698-65382720 CCTCCTTGCCAGCACCCCAGAGG + Exonic
1128379641 15:67103198-67103220 CCTGCCTCCCATCACCCCAGTGG + Intronic
1128791730 15:70439182-70439204 CTTTCTCCCCAGCCCCCCAAAGG - Intergenic
1128883952 15:71268156-71268178 CATTCTTCTCAGCACCACATCGG + Intronic
1132352515 15:101148788-101148810 CATTCTTCCGAGCACCTCAGAGG - Intergenic
1135778556 16:25278468-25278490 CAGGCTTCCAAGCACAGCAAGGG + Intergenic
1137364012 16:47845060-47845082 CATGATTCCCAATAGCCCAAAGG + Intergenic
1138071990 16:54001831-54001853 CATGCATCCCAGCATCCCTTGGG + Intronic
1138588901 16:57988716-57988738 CATGCTTGCCAGCTGCCCACAGG - Intergenic
1139527316 16:67524948-67524970 CAGGCTCCCCATCACCCCAAGGG + Intronic
1139558684 16:67728454-67728476 CATGCTTCCTAGCACACCGTTGG + Exonic
1140475835 16:75238872-75238894 CAGGCCTCCCAGCCTCCCAAAGG + Intronic
1141197842 16:81874687-81874709 CATGCTTATCAGCAGCCAAATGG + Intronic
1144945946 17:18969512-18969534 GATGCTACCCAGAACCCCAACGG - Exonic
1144949757 17:18987662-18987684 CATGGTTTCCCCCACCCCAAAGG + Intronic
1146100681 17:29978927-29978949 CATGCTTCCCAGCTTCCCTGGGG + Intronic
1147391010 17:40109155-40109177 CAGGCTTCCCAGAATCCCAAGGG - Intergenic
1147983846 17:44292817-44292839 CATCCTTCCCAGGAACCCACTGG - Intergenic
1148239406 17:45990247-45990269 CATCCCTCTCAGCACCCCACAGG + Intronic
1148748458 17:49931302-49931324 AAAGAGTCCCAGCACCCCAAAGG - Intergenic
1148850221 17:50550986-50551008 CATTCTCCTCAGGACCCCAAGGG + Exonic
1150005038 17:61463975-61463997 CCTGCTTACCAGCCCCCCTATGG - Intronic
1150462164 17:65361883-65361905 CTTTCTTCCCAGCACCCAGATGG - Intergenic
1154070515 18:11148634-11148656 CTTGCGTCCCACCACCCCTAGGG - Intronic
1154283937 18:13034285-13034307 CATCCTTCCCAGCACCCATCAGG - Intronic
1160688902 19:451459-451481 CATAACTCCCAGCAGCCCAAAGG - Intronic
1161128631 19:2574649-2574671 CATGATTCCCAACAGCCCCAGGG - Intronic
1161635199 19:5384203-5384225 CATGATTCCCAACAGCCAAAAGG - Intergenic
1162809543 19:13155704-13155726 CAGGCTTCCCATGACCCCAGGGG + Intergenic
1162965053 19:14151588-14151610 CAGGCTTCCCGGCCTCCCAAGGG + Exonic
1163783635 19:19263166-19263188 CCTGGTCTCCAGCACCCCAAAGG + Intergenic
1164512989 19:28912441-28912463 CCTGCTTCCCAGAACCCTAATGG - Intergenic
1164615154 19:29663306-29663328 GGTGTTTCCCAGCATCCCAATGG + Intergenic
1165309768 19:35022985-35023007 CATGCCCCCCAGCTCCCCCAGGG + Intronic
1165467506 19:35983734-35983756 CCTGGTTACCAGGACCCCAAGGG - Intergenic
1166434859 19:42758745-42758767 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166444734 19:42848768-42848790 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166454624 19:42930188-42930210 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166464424 19:43019516-43019538 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166470577 19:43076100-43076122 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166481700 19:43179624-43179646 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1166484172 19:43198741-43198763 CAGGCTTTCCAGTACCCAAAGGG - Intronic
1167240518 19:48340601-48340623 CAGGCTCCATAGCACCCCAAGGG + Intronic
925105797 2:1290058-1290080 CATTATTCCCAGCAGCCCAAAGG - Intronic
926723721 2:15981832-15981854 AAGGCTTCCCAGACCCCCAATGG + Intergenic
931190844 2:59998789-59998811 CATGCTTCTCAGGACCACCAAGG + Intergenic
932688999 2:73896617-73896639 CACCCTCCCCAGCACCTCAAAGG - Intronic
932795583 2:74692461-74692483 CAGGCTTCTCAGCCCCACAATGG - Intergenic
933221997 2:79701371-79701393 AAAGCACCCCAGCACCCCAAAGG + Intronic
934753995 2:96812654-96812676 GAACCTTCCCACCACCCCAAGGG + Intergenic
938991896 2:136638161-136638183 TTTGCTTCCCAGCACACCATTGG - Intergenic
940773249 2:157860399-157860421 AATGCTACCCACCACCCCTAGGG + Intronic
944830739 2:203531958-203531980 CATTATTCACAGTACCCCAAAGG + Intronic
947473525 2:230419795-230419817 GATGCTTCCAAGAACCCCAGTGG - Intronic
947767268 2:232645735-232645757 CATGCTTCACGACACTCCAAAGG + Intronic
948748163 2:240110644-240110666 CATGCTGCCCCCCACCCCCAAGG + Intergenic
1169635369 20:7685242-7685264 CAGCCTTCCCAGTAGCCCAAAGG - Intergenic
1171271406 20:23821374-23821396 CCTGCTTCCCAGGCCTCCAATGG + Intergenic
1173450862 20:43162725-43162747 CATGGTTCCAACCACACCAAAGG + Intronic
1175194443 20:57233244-57233266 GTTACATCCCAGCACCCCAAGGG + Intronic
1175347808 20:58294779-58294801 CTTGCTTCCCCCCACCCCCAGGG - Intergenic
1176983414 21:15408767-15408789 CATGTTTCCCAGCACCCCATAGG - Intergenic
1179599495 21:42466627-42466649 CATGAGTCCCAGATCCCCAAAGG - Intergenic
1180203097 21:46239057-46239079 CATTCTCCCCAGCATCCCCATGG - Intronic
1180924127 22:19541569-19541591 CATCATTCACAACACCCCAAAGG + Intergenic
1184745489 22:46453322-46453344 AAGGCTGCTCAGCACCCCAACGG + Intronic
949694860 3:6682505-6682527 CATGCCTCCCAGCTCCTCATTGG - Intergenic
950183789 3:10932894-10932916 CTCACTTTCCAGCACCCCAAGGG - Intronic
954036568 3:47854020-47854042 CACGCTTTCCAGCTCCCCAGTGG - Intronic
955422179 3:58749719-58749741 CATGCTTACCAGCTCCAAAATGG - Intronic
960061971 3:113332367-113332389 GATGCATCCCAGCAGCACAAGGG - Intronic
960148526 3:114228723-114228745 TATCCTTCCCACCATCCCAAGGG - Intergenic
960824529 3:121768691-121768713 CATGTTTGCCTGTACCCCAAAGG + Intergenic
962285382 3:134081491-134081513 CCTGTTTCCCAGCTCCACAAGGG - Intronic
964498977 3:157327204-157327226 AATGCTTTCCACCACCACAAGGG + Intronic
967267672 3:187705001-187705023 CATGCTTCCCAGCACCCCAAAGG + Intronic
967752451 3:193129815-193129837 CCTGCTTCCCAGCACCTCTGTGG - Intergenic
968123622 3:196143086-196143108 CATGCATTCCAGCACCCTGATGG - Intergenic
968533693 4:1111023-1111045 CACACTTCCCAGCACCACGAAGG + Intronic
968974166 4:3812360-3812382 GGTTCTTCCCAGCACCCCACGGG + Intergenic
969054307 4:4392155-4392177 CATCCTTCCCCCCATCCCAATGG + Intronic
970437697 4:16051418-16051440 AATGTTTCCCAGCACTCAAAAGG - Intronic
971423496 4:26494291-26494313 CATGCTTCCCAGCCAGCCAGGGG - Intergenic
972178526 4:36437523-36437545 CATTCTTCTCAGCACCACATTGG - Intergenic
975095798 4:70454759-70454781 TATTCTTCCCAGAAACCCAACGG + Intronic
976775030 4:88698293-88698315 CATGCACCCCAGGTCCCCAAAGG - Intronic
985269522 4:188180645-188180667 AAGGCTTCCAAGCACCCCACAGG + Intergenic
987494525 5:18626948-18626970 CATCCTCTCCAGCACCCCACAGG - Intergenic
988381041 5:30497270-30497292 CATTCTTCTCAGCACCACATCGG - Intergenic
990651803 5:57908778-57908800 CATGCTTGACAGCAAGCCAAAGG - Intergenic
991031136 5:62083501-62083523 TAGGCTTCCCAGCAGCCCAGTGG - Intergenic
991545170 5:67773620-67773642 CATGCTTCCCACCAACACAAAGG + Intergenic
994118219 5:96084667-96084689 CCTGCTTCCCAGCCTCCCAGTGG - Intergenic
994722131 5:103392587-103392609 CCAAATTCCCAGCACCCCAATGG - Intergenic
994759342 5:103834126-103834148 CATCCTTCACAGCAGCCCAAGGG + Intergenic
994804544 5:104427782-104427804 CATGCTTCCCAGACCCTCAAAGG - Intergenic
995952793 5:117736927-117736949 CATGCTTTCCATCACCATAATGG - Intergenic
996410811 5:123156716-123156738 CCTGCTTCTCAGCTCCCCAGAGG - Intronic
997187413 5:131896330-131896352 CATTCTTCTCAGCACCGCATTGG - Intronic
998088062 5:139342609-139342631 AAGGGTTCCCAGTACCCCAAAGG - Exonic
1001686635 5:173598527-173598549 GATCCTTCCCAGCCCCCCGAGGG - Intergenic
1001827603 5:174758410-174758432 CATGTTTCCCAGCACAATAAAGG + Intergenic
1004685027 6:17934995-17935017 CAGGCTTCCCACCACGCTAAGGG + Intronic
1005813124 6:29531125-29531147 CATGCTTCTCAGTTCCCCCATGG - Intergenic
1006289862 6:33126415-33126437 CATGCTTCCCAGGACACCTATGG + Intergenic
1007316552 6:40993858-40993880 CATCCTTCCCAGTACCCTGATGG + Intergenic
1007466482 6:42055351-42055373 CATGATTCACAGCAGCCAAAAGG - Intronic
1007601088 6:43081749-43081771 CATTCTGCCCTGCACCCAAATGG - Intronic
1007941871 6:45789160-45789182 CATGCTTCTCAGCAGCCCAGTGG - Intergenic
1013602558 6:111718694-111718716 CATCCTTCCCACCTTCCCAAAGG - Intronic
1018089018 6:160329513-160329535 CCTGCCTCCCACCACCCCACAGG - Intergenic
1018936831 6:168279261-168279283 GAGGCTCCCCAGCACCCCAGAGG + Intergenic
1019151659 6:170010684-170010706 GATGCTTCCCATCACACCCAGGG + Intergenic
1019721400 7:2574334-2574356 GTTTCTTCCCAGCTCCCCAATGG - Intronic
1023551492 7:41374571-41374593 CATGCTGCCCTGCACCTCCAAGG + Intergenic
1027995703 7:85423539-85423561 GTGGCTTCCCAGGACCCCAAGGG - Intergenic
1028100908 7:86819574-86819596 CATGCTGCCCAGCAGGCCTAGGG + Intronic
1029125889 7:98295066-98295088 GAAGCGTCCCAGCACCCCCAGGG + Intronic
1029369476 7:100139185-100139207 AATTCTTCCCACAACCCCAAAGG + Intergenic
1031028288 7:116705928-116705950 CATGTTTTCTAACACCCCAAGGG - Intronic
1032655761 7:133928258-133928280 CATCCTGCCCACCACCACAATGG - Intronic
1035303396 7:157913500-157913522 CATGCTTCCCAGCAAAACACTGG - Intronic
1035818122 8:2562321-2562343 CATGGTTTCCTGCACCGCAACGG - Intergenic
1036400715 8:8405271-8405293 ATTGCTTCCCTGGACCCCAAAGG - Intergenic
1042264207 8:66891991-66892013 CATGCTTCCCTGCAGCCCCTTGG - Intronic
1042853254 8:73238287-73238309 CATTCTTCTCAGCACCACATCGG - Intergenic
1044870852 8:96618516-96618538 AATGCTTCCCAGATCCCCCAAGG - Intergenic
1048189443 8:132274756-132274778 CCCACTTCCCAGCACCCCACTGG - Intronic
1049224761 8:141444909-141444931 CATGCCACCCAGCACCACCACGG - Intergenic
1049299277 8:141861233-141861255 CAGCCTGCCCAGCACCCCATGGG - Intergenic
1049425489 8:142536205-142536227 CATGCCCCCCACCACCCCCAAGG + Intronic
1051377627 9:16419506-16419528 TATGGTGCCCAGCACCCCATGGG - Exonic
1051847713 9:21471043-21471065 AATGCTACCCAGCACCAGAAAGG + Intergenic
1057999095 9:99847306-99847328 CATGCTTCATAGCACCACACTGG + Intronic
1058901475 9:109446234-109446256 AATTCTTCCCAGCACCCCAGTGG + Intronic
1059283322 9:113152573-113152595 CTTGGTCCCCAGCACCCCCAGGG + Intronic
1062267993 9:135696125-135696147 CATGCTTCCCAGCAGACCCAGGG + Intronic
1062268025 9:135696239-135696261 CATGCTTCCCAGCAGACCCAGGG + Intronic
1189055373 X:37694089-37694111 GATGCTTTCCAGCAGGCCAATGG - Intronic
1191097191 X:56686075-56686097 CATTCTTCTCAGCACCTCATCGG - Intergenic
1191868296 X:65723731-65723753 AATGGTTCACAGCACCCCCATGG + Intronic
1192582836 X:72299258-72299280 CAAGCTTCTCTCCACCCCAAGGG + Intronic
1196561486 X:117154367-117154389 CATTCTTCTCAGCACCACATGGG + Intergenic
1196895424 X:120331174-120331196 GTTGCTTACCAGCACGCCAAAGG + Intergenic
1197309209 X:124883603-124883625 CCTGCTGGCCAGCAGCCCAAGGG - Intronic
1197395337 X:125920771-125920793 CATTCTTCTCAGCACCACATAGG - Intergenic
1199654013 X:149976663-149976685 CATGCTTTCCTACACCCAAATGG + Intergenic
1201152852 Y:11103232-11103254 CATTCTTCCCAGCACCCACACGG + Intergenic