ID: 967267930

View in Genome Browser
Species Human (GRCh38)
Location 3:187707438-187707460
Sequence GCCAATTGGTCATCCTGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 74}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967267930_967267938 23 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267938 3:187707484-187707506 GGGGTGCTTTTCCCTAAGGAGGG 0: 1
1: 0
2: 3
3: 5
4: 110
967267930_967267935 4 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267935 3:187707465-187707487 AAATAAAAAAAATGTTAAAGGGG 0: 1
1: 1
2: 80
3: 766
4: 5798
967267930_967267934 3 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267934 3:187707464-187707486 TAAATAAAAAAAATGTTAAAGGG 0: 1
1: 1
2: 55
3: 585
4: 4588
967267930_967267933 2 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267933 3:187707463-187707485 TTAAATAAAAAAAATGTTAAAGG 0: 1
1: 1
2: 48
3: 535
4: 3567
967267930_967267936 19 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267936 3:187707480-187707502 TAAAGGGGTGCTTTTCCCTAAGG 0: 1
1: 0
2: 0
3: 5
4: 65
967267930_967267939 24 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267939 3:187707485-187707507 GGGTGCTTTTCCCTAAGGAGGGG 0: 1
1: 0
2: 2
3: 14
4: 124
967267930_967267937 22 Left 967267930 3:187707438-187707460 CCCTTACAGGATGACCAATTGGC 0: 1
1: 0
2: 1
3: 9
4: 74
Right 967267937 3:187707483-187707505 AGGGGTGCTTTTCCCTAAGGAGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967267930 Original CRISPR GCCAATTGGTCATCCTGTAA GGG (reversed) Intronic
908813605 1:68009200-68009222 CCCATTTGGCCATCTTGTAATGG + Intergenic
922376874 1:224977761-224977783 GCCAACTGTTCATTCTATAAGGG + Intronic
923920332 1:238556939-238556961 ACCAATTGATGATTCTGTAAAGG - Intergenic
1064917468 10:20476435-20476457 GCCAATTAATAATCCTGTAATGG + Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1070540197 10:77410175-77410197 GGCAATTTGACATCCTGTTAGGG - Intronic
1070569469 10:77630330-77630352 GCCAGTTGGTCATTCTGCAAAGG - Intronic
1072166687 10:92820390-92820412 GCCAATTAGTAATCCTACAATGG - Intergenic
1075823798 10:125336499-125336521 GCCAATGGTTCATCCTCAAAGGG + Intergenic
1077388011 11:2283213-2283235 GACAATTTCTCAGCCTGTAAAGG + Intergenic
1078398935 11:11006997-11007019 GCCAATTAGTAATCCTACAATGG - Intergenic
1078523949 11:12086494-12086516 GCAAATAGGTCATCAAGTAATGG + Intergenic
1080526273 11:33123392-33123414 TCCCATTGATAATCCTGTAAAGG - Intronic
1082761834 11:57134734-57134756 GCCAATTAGTAACCCTGCAAGGG - Intergenic
1088001539 11:104887728-104887750 GCAACTTGGTCATCTTGAAATGG - Intergenic
1089583078 11:119493673-119493695 GGAAAATGGTCATCTTGTAAAGG + Intergenic
1091366115 11:135022122-135022144 GCTAATTGGTCTTCCTGATAAGG + Intergenic
1100460393 12:94793667-94793689 ACCAAATGGTCTCCCTGTAATGG + Intergenic
1108823283 13:54379672-54379694 GCCAATGGCTCATCCTGAAATGG + Intergenic
1108916146 13:55614556-55614578 GGCATTTAGTTATCCTGTAAAGG - Intergenic
1110014404 13:70383110-70383132 ATCAATTCTTCATCCTGTAAAGG - Intergenic
1110560043 13:76901517-76901539 GCCTTTTGGTCTTCCTGTATGGG - Intergenic
1110689724 13:78418214-78418236 GCCAGTGGGTTCTCCTGTAAGGG + Intergenic
1114815439 14:25952499-25952521 GCCAATTAATAATCCTGCAATGG - Intergenic
1117519554 14:56537156-56537178 GCCAATTAATAATCCTATAAAGG + Intronic
1119140375 14:72262178-72262200 GACAATTTGTCATGCTGTGAGGG - Intronic
1124461030 15:29891861-29891883 GCCAATTGATAACCCTGTAAGGG + Intronic
1125427577 15:39565034-39565056 GTTAATTTGTCATTCTGTAATGG - Intergenic
1146050463 17:29547841-29547863 GCCAACTCTTCATCCTTTAAGGG - Exonic
1146329095 17:31912880-31912902 GCCATTTGGTTCTCCTTTAAAGG + Intergenic
1151217775 17:72589515-72589537 TCCAATTTGGGATCCTGTAATGG - Intergenic
1156498178 18:37539851-37539873 CCAAATTGGTCATGCTGTCATGG + Intronic
1156785617 18:40910356-40910378 GCCAATTGATAATCCTATAATGG - Intergenic
1157137212 18:45067890-45067912 GCCAACTGGTCAACGTGGAAGGG + Exonic
1160166195 18:76514630-76514652 GCCAATTAGTAACCCTGCAATGG - Intergenic
1167026906 19:46926519-46926541 GCCTTTTGGTCATGCTGAAATGG + Intronic
929431543 2:41891841-41891863 GCCAATTATTCAACCTGAAATGG + Intergenic
930127918 2:47817660-47817682 GCCAATTAGTAATCCTCAAATGG - Intronic
931683888 2:64776409-64776431 GCCAATTAGTAACCCTGCAATGG - Intergenic
933476303 2:82795628-82795650 GCCCATTAGTCATCCTTCAATGG - Intergenic
933906264 2:86896604-86896626 ACCAATTAGTAACCCTGTAATGG + Intergenic
936948230 2:117950561-117950583 GCCACTAGGTTATCCTGGAAGGG + Intronic
1169555026 20:6740340-6740362 GGCTATCGGTCATCCTGTGAAGG - Intergenic
1174991379 20:55514158-55514180 GACAATTAATCATCCTGCAATGG - Intergenic
1175803215 20:61812924-61812946 CCCATTTGGTCATCATGTTAGGG - Intronic
1181930624 22:26398254-26398276 GCCAATTAATAATCCTGCAATGG - Intergenic
949112382 3:277535-277557 AGCAATTGGTCATTCTGAAAAGG - Intronic
958764099 3:98343915-98343937 GTCAATTGGTAAGCCTATAACGG + Intergenic
959594606 3:108115370-108115392 GACAATTGGTCACCCTACAATGG + Intergenic
962914491 3:139887413-139887435 AGCAATTGTTCATTCTGTAAAGG + Intergenic
967267930 3:187707438-187707460 GCCAATTGGTCATCCTGTAAGGG - Intronic
967294429 3:187951259-187951281 GCCACTTGCTCTTCCTGGAAGGG + Intergenic
967710780 3:192705301-192705323 GCCAATTAGTCACCCTAAAATGG - Intronic
967808680 3:193736992-193737014 ACCAATTGGTCATCCTGTCTTGG + Intergenic
972747610 4:41953634-41953656 GCCAATTAATAACCCTGTAATGG - Intronic
978419067 4:108510956-108510978 TCCATTTGGCCATCCTCTAATGG + Intergenic
980952868 4:139398943-139398965 GCCAATTAATCACCCTGCAATGG - Intronic
982439995 4:155424145-155424167 GCCAGTTGGTCATTTTTTAAAGG - Intergenic
987946631 5:24617861-24617883 CCCAATTGGTCATCTTGTGAAGG + Intronic
989437408 5:41430969-41430991 ACCAATTGGTCATCCTCTAATGG + Intronic
992436845 5:76762724-76762746 GCCCATTGGTTATCCAGGAATGG + Intergenic
993157249 5:84241404-84241426 GCAAAATGGGAATCCTGTAAAGG - Intronic
994730343 5:103483822-103483844 GCCAATTGTTCTTCTTGGAATGG - Intergenic
998260868 5:140631062-140631084 GCCAATCAGTCAGCCTGAAAAGG + Intergenic
999902544 5:156100697-156100719 ACTAATTGGGCAACCTGTAATGG + Intronic
1000954911 5:167531818-167531840 GCCAATTAGTTATCCTGCAATGG + Intronic
1015246686 6:131082611-131082633 GCCAATTGGTAAACATTTAAAGG + Intergenic
1015737811 6:136419815-136419837 GACAATTTTTGATCCTGTAAGGG + Intronic
1024570011 7:50715446-50715468 ACCAATTGTTCCTGCTGTAATGG - Intronic
1028178300 7:87683478-87683500 GCCAATTAATAATCCTATAATGG - Intronic
1029066317 7:97852321-97852343 TCCACTTGGGCATCCAGTAATGG + Exonic
1032536993 7:132672576-132672598 GCCATCTGGTCATCCTGTCCCGG - Intronic
1035600306 8:893352-893374 TCGAATTGGTCATCCTGGCAGGG - Intergenic
1036983607 8:13499822-13499844 GCCAATGGGTCATCTTTCAAAGG - Exonic
1037417140 8:18664106-18664128 ACCAATTAGTAATCCTGCAATGG + Intronic
1040364245 8:46698604-46698626 TCCACTTGGGCATCCAGTAATGG - Intergenic
1042531462 8:69820170-69820192 GCCAATAGGACATCCTCTAGAGG + Intronic
1048297915 8:133228452-133228474 GTCAATTGGTCCTTCTGAAACGG - Exonic
1055297099 9:74844908-74844930 GCCAATTAATAATCCTATAATGG - Intronic
1055869952 9:80864535-80864557 ACCACTTGGTCATTATGTAATGG + Intergenic
1056434665 9:86564149-86564171 GCCAAATGTTAATCCTGTATCGG + Intergenic
1185969317 X:4644326-4644348 GCCAAAAGGTTATACTGTAAAGG - Intergenic
1188432661 X:30122640-30122662 GCCAATTAGTCATCCTACAATGG + Intergenic
1197837124 X:130706744-130706766 GACAATTTGTCATTCTGAAAAGG - Intronic
1198391272 X:136177205-136177227 GCAAATTTATAATCCTGTAATGG - Intronic