ID: 967268470

View in Genome Browser
Species Human (GRCh38)
Location 3:187713188-187713210
Sequence CACCACCTGCATCACAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 2, 1: 0, 2: 1, 3: 20, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967268470_967268474 0 Left 967268470 3:187713188-187713210 CCTACACTGTGATGCAGGTGGTG 0: 2
1: 0
2: 1
3: 20
4: 172
Right 967268474 3:187713211-187713233 GGCGCCATGGCATGTCCCAGTGG 0: 1
1: 0
2: 0
3: 14
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967268470 Original CRISPR CACCACCTGCATCACAGTGT AGG (reversed) Intronic
900193430 1:1361396-1361418 CACCACATGCAGCACAGTCCAGG - Intronic
900915432 1:5635133-5635155 CACCACTTGGACCATAGTGTTGG + Intergenic
900956329 1:5888254-5888276 CCCCACATGCCTCACAGTGTTGG - Intronic
900976434 1:6019716-6019738 CAGCACGTGCTGCACAGTGTCGG + Intronic
902773811 1:18661611-18661633 CAACACCCACCTCACAGTGTCGG + Intronic
903192651 1:21665643-21665665 CACCACCTGCCTGACAGTGCTGG + Intronic
903887380 1:26548271-26548293 CACCGGCTGCACCACACTGTCGG - Intronic
904249572 1:29213479-29213501 CCCCACCTGTATCACAGAGGAGG + Intronic
905309007 1:37036784-37036806 CTCCTCCTGCATCCCAGAGTGGG + Intergenic
906700137 1:47851774-47851796 CACCACATGCATCACTGTCCTGG + Intronic
907452145 1:54552249-54552271 CCCCACCTCCAACACAGAGTAGG - Intronic
907520557 1:55020775-55020797 GGCCACCTGCATCAGAGTGGTGG - Intergenic
908110391 1:60891289-60891311 CACCACCTGCTTCTCAGAGCTGG + Intronic
910444210 1:87284170-87284192 CACCACCTCCCTCAAAGGGTAGG + Intergenic
910697633 1:90037490-90037512 TACCACCTGGATGACAGTGATGG + Intergenic
912722689 1:112033246-112033268 CCCCTCCTGCATCTCAGTCTGGG + Intergenic
912775390 1:112503417-112503439 CAGCTCCTGCAACACAGTGCAGG - Intronic
913593938 1:120355312-120355334 CACCACCTTCACCTCCGTGTAGG + Intergenic
914596849 1:149162597-149162619 CACCACCTTCACCTCCGTGTAGG - Intergenic
915290131 1:154877956-154877978 CATCACCTACACCACAGTGTGGG - Intergenic
916854598 1:168736930-168736952 GACCACCTGCATCACAGCCATGG + Intergenic
919740666 1:200979572-200979594 CACCTCCTACATCAAGGTGTGGG - Exonic
921202910 1:212824163-212824185 AAGCACCTGCCTCACAGTGCAGG + Intergenic
924432299 1:244007508-244007530 GACCACCTGCATGACTGTGAGGG + Intergenic
1063117168 10:3079724-3079746 CATCACCTGCTTCCTAGTGTTGG + Intronic
1069885031 10:71618336-71618358 CACACCCTGCATCACAGGGGCGG + Intronic
1070279467 10:75038104-75038126 CAACACCTGCCCCTCAGTGTGGG - Intronic
1070646365 10:78204770-78204792 CACAACTTGAATCACAGTGGCGG + Intergenic
1073226507 10:101925168-101925190 CAGCAGCTGAATCACATTGTTGG - Intronic
1074212765 10:111352613-111352635 CACCACCTACATCACAGAGGGGG - Intergenic
1077552753 11:3208618-3208640 CACCACATGCATCACAGCAAAGG - Intergenic
1078415772 11:11163389-11163411 CGCCACATGCATCAGAGGGTGGG + Intergenic
1078605490 11:12771402-12771424 CACCGCCTGCATCCTAGTGCAGG - Intronic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1082005234 11:47415550-47415572 CAGCACAGGGATCACAGTGTCGG - Exonic
1083016292 11:59457610-59457632 CATCACCAGAATGACAGTGTAGG - Exonic
1085373178 11:76030897-76030919 CACTACCTGCATCATTGAGTTGG - Intronic
1085458514 11:76679208-76679230 CACCACCTGCACCACCCTGGTGG - Intergenic
1086397543 11:86432402-86432424 CAAGACCTGCAACACAGTGAAGG - Intergenic
1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG + Intergenic
1089083345 11:115796129-115796151 CTCCACCAGCATCACTGTGGTGG - Intergenic
1089190929 11:116652784-116652806 CACCACCATTATCACAGTGCTGG - Intergenic
1090014932 11:123077573-123077595 GCCCACCTCCATCAAAGTGTTGG + Intronic
1090925846 11:131249871-131249893 CCCCACCTCCATCACACTGGAGG + Intergenic
1091339692 11:134800752-134800774 CACTCCCAGCATCACTGTGTGGG + Intergenic
1092194734 12:6542358-6542380 CTCCGCCTGCCTCAGAGTGTGGG - Intronic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1093638676 12:21501121-21501143 CACCCCCTGCTTCACAGTAGCGG - Intronic
1095878897 12:47111255-47111277 CAACACCTGTATTAGAGTGTTGG + Intronic
1096542963 12:52318479-52318501 CACCACCTGCAGCTGAGTGGGGG - Intronic
1097166843 12:57090548-57090570 CACCACCTGGCTCACTGAGTGGG + Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1104268280 12:127258902-127258924 CAAGACCTTCATCGCAGTGTGGG - Intergenic
1104782266 12:131429414-131429436 AGGCACCTGCATCACTGTGTGGG - Intergenic
1105356756 13:19665712-19665734 CAGCATCTGCCTCACAGGGTAGG + Intronic
1107450300 13:40502422-40502444 CAACACCTGACTCAGAGTGTTGG + Intergenic
1107725956 13:43299457-43299479 CAGCACCGGCATCACAGGCTTGG - Intronic
1109603649 13:64663653-64663675 CCCCACCTCCACCACATTGTGGG + Intergenic
1109798827 13:67347988-67348010 CACCTCCTGAATAACAGTCTCGG + Intergenic
1111518067 13:89361673-89361695 CACCACCTGCTTTACAGTTGGGG + Intergenic
1113071223 13:106423472-106423494 CACCACACACATCACAATGTGGG + Intergenic
1113683011 13:112257372-112257394 CCACACCTGCCTCAAAGTGTGGG - Intergenic
1122038302 14:98964333-98964355 CATCTCCTGCAGCACAGGGTGGG - Intergenic
1122343773 14:101045562-101045584 CACCATCTCCTTCCCAGTGTGGG - Intergenic
1122602853 14:102929988-102930010 CACCACCTGGATCTCCGTATCGG - Exonic
1123143510 14:106105985-106106007 CTTCACCTGACTCACAGTGTAGG + Intergenic
1123191586 14:106576773-106576795 CTTCACCTGACTCACAGTGTAGG + Intergenic
1129687317 15:77694289-77694311 CCCTATCTGCCTCACAGTGTGGG - Intronic
1131413684 15:92232757-92232779 TTTCACCTGCCTCACAGTGTAGG - Intergenic
1135496694 16:22957577-22957599 CTCCGCCTGCACCTCAGTGTAGG - Intergenic
1137359418 16:47799496-47799518 CACCCCTTAAATCACAGTGTGGG + Intergenic
1138288787 16:55830093-55830115 CAACACCTCCCTCAAAGTGTGGG + Intronic
1138455358 16:57117655-57117677 CACCACCTCCATCACATTCTAGG + Intronic
1140666021 16:77228335-77228357 CACCACCTGGATCCCACTTTGGG + Intergenic
1140694263 16:77516746-77516768 CACCACCTGCAACCCAGTCTTGG + Intergenic
1141246481 16:82312541-82312563 GACCACCTGAATCAGAGTCTGGG + Intergenic
1142312008 16:89319638-89319660 CACCACCCTCATCACAGTCATGG + Intronic
1143527761 17:7482337-7482359 CACCACCTGAACCGCACTGTAGG - Exonic
1144276236 17:13671524-13671546 CTTCACCTGACTCACAGTGTGGG - Intergenic
1145314134 17:21719092-21719114 CACAACCTGCACTGCAGTGTGGG - Intergenic
1145795570 17:27653607-27653629 CACCAGCTGCTTCAGGGTGTGGG + Intergenic
1145810006 17:27758938-27758960 CACCAGCTGCTTCAGGGTGTGGG + Exonic
1146050309 17:29545807-29545829 CACTACCTCCTTCCCAGTGTTGG + Exonic
1146730998 17:35193933-35193955 CACCACCTGAACCGCACTGTAGG + Exonic
1147441109 17:40447756-40447778 CAGGACCTGCCTCACAGGGTTGG + Intronic
1147969856 17:44213380-44213402 CACTCCCTGCATCACAGCGTGGG - Intronic
1148387433 17:47244453-47244475 CAACTCATCCATCACAGTGTGGG + Intergenic
1149544580 17:57493859-57493881 CTCCGCCTACCTCACAGTGTTGG - Intronic
1149743808 17:59075033-59075055 CACCACTTAAGTCACAGTGTGGG + Intronic
1153078184 18:1189968-1189990 CACCACCTGCATCCCTGGCTCGG - Intergenic
1154038900 18:10834467-10834489 CGGCACCTGCATCACAGAGTGGG - Intronic
1157164966 18:45350402-45350424 CAGCACGTTCATCACAGTGAGGG + Intronic
1160656758 19:276448-276470 AACCACCTGCATAACTGTCTAGG + Intergenic
1160751674 19:737316-737338 CACAACCTGCTCAACAGTGTGGG + Intronic
1160792397 19:928715-928737 CCCTACCTGCAAAACAGTGTGGG - Intronic
1163327148 19:16612070-16612092 AACAACCTGCATCACCCTGTTGG - Intronic
1164895898 19:31877390-31877412 CACCACCTGCACTCCAGTCTGGG + Intergenic
1165430199 19:35767775-35767797 CTCCATCTGAATCCCAGTGTCGG + Intronic
1167733176 19:51273857-51273879 CAAGGCCTGAATCACAGTGTTGG + Intergenic
925194236 2:1910420-1910442 CTCCACCTGCATCAGGGTCTTGG - Intronic
927168459 2:20348885-20348907 CACCACCTGCACTGCAGTCTGGG + Intronic
927977143 2:27347391-27347413 CAGCACCTGCCTCAGAGGGTTGG - Intronic
929132125 2:38586982-38587004 CAGCACCTGGATCACAATGGGGG + Intronic
929880579 2:45833537-45833559 CAGGACCTGCTTCAGAGTGTTGG - Intronic
930330609 2:49978507-49978529 CACCACAGGCCTGACAGTGTGGG - Intronic
931322885 2:61189108-61189130 AAACAACTGCATCAAAGTGTTGG - Exonic
933553339 2:83802799-83802821 CTCCACCAGCACCACAGTGTGGG + Intergenic
935169386 2:100599133-100599155 CTCCACCTGCATTACATTCTGGG + Intergenic
935448005 2:103176754-103176776 CACTCCCTGCATCACAATATGGG - Intergenic
937957838 2:127431876-127431898 CACCTCTGGCATGACAGTGTTGG + Intergenic
939096285 2:137836938-137836960 CACCACCTGTATCACTGGCTGGG + Intergenic
940259538 2:151765790-151765812 CACCACCACCACCACAGAGTGGG + Intergenic
948730533 2:239961080-239961102 CTCCAGCTGCATCACAGTGATGG - Exonic
1169492171 20:6080574-6080596 CACCACCACCATCACAGAGCCGG - Intronic
1171186804 20:23128775-23128797 GACCACCAGCCTCACAGTGGTGG - Intergenic
1172615954 20:36284641-36284663 TAACACCTCCAGCACAGTGTAGG + Intergenic
1172699983 20:36847108-36847130 CAGCACCTACCTCACAGGGTCGG - Intronic
1174620525 20:51870917-51870939 TACCACCTATATCACAGTGGTGG - Intergenic
1176802341 21:13443578-13443600 CACCACGTGTAGCAGAGTGTAGG + Intergenic
1180189186 21:46154553-46154575 CACCACCTGCAGCCCCTTGTGGG - Intronic
1180199008 21:46213662-46213684 CCCCAGCTGCATCCCAGTGAGGG - Intronic
1182006048 22:26960514-26960536 CACCAAGGGCATCACAGTGAGGG + Intergenic
1184759348 22:46536144-46536166 CACCACCTACATCACTGTCTTGG - Exonic
1184920499 22:47602049-47602071 AACCACCCGAATCACAGTCTTGG + Intergenic
1185185706 22:49398385-49398407 CACAGCCGGCATCACAGTGCTGG - Intergenic
950685027 3:14610726-14610748 CACCAACTGAATGACAGTTTCGG + Intergenic
950792303 3:15482240-15482262 CACCACTCCTATCACAGTGTTGG - Intronic
953425664 3:42795461-42795483 ATCCACCTGCCTCCCAGTGTTGG + Intronic
953789078 3:45932610-45932632 CACCACTTGCTGCGCAGTGTTGG - Intronic
955893450 3:63674745-63674767 CAGCACCTGCATCTCTCTGTTGG + Intronic
955902107 3:63767566-63767588 AATCTCCTACATCACAGTGTGGG + Intergenic
958126635 3:89364982-89365004 CACAACATACAGCACAGTGTTGG - Intronic
960252395 3:115470441-115470463 CAGCACCTGCATCACTTTGTTGG - Intergenic
961537760 3:127580289-127580311 CACCCACTGCAGCTCAGTGTGGG + Intronic
966168126 3:177044807-177044829 CACCATCTCCAACACAGAGTTGG + Intronic
967268470 3:187713188-187713210 CACCACCTGCATCACAGTGTAGG - Intronic
971061546 4:22977741-22977763 TATCCCCTGGATCACAGTGTAGG - Intergenic
972451537 4:39204685-39204707 CATCACCTGCAGGTCAGTGTTGG - Intronic
973878186 4:55241868-55241890 CTCCACCTGCGGCCCAGTGTGGG + Intergenic
975361604 4:73477248-73477270 CCCCACCTGCATCACATTGCAGG - Intergenic
976359296 4:84158723-84158745 CACCACCACCACCACAGTGCTGG + Intergenic
977432761 4:96952890-96952912 CACCACCTGCAGCACATTTTAGG - Intergenic
981253247 4:142628829-142628851 CACAGCCTGCATCACAGGGAAGG + Intronic
981757393 4:148155254-148155276 CACCAACTGCACCGCAGTGCAGG + Intronic
984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG + Intergenic
988388940 5:30602311-30602333 CACCAGCTGCATCTCAGTGTTGG + Intergenic
989178390 5:38552893-38552915 AACCACCTTCATCACATAGTGGG - Intronic
998385427 5:141754546-141754568 CACCACCACCACCACAGGGTGGG + Intergenic
998690330 5:144580697-144580719 CAGTACCTGCATCACAGGATGGG + Intergenic
1003126095 6:3356897-3356919 CACCACCTGCATCACAGTGTCGG - Intronic
1005360251 6:25024412-25024434 CACCTCCTGCATCCTCGTGTGGG - Intronic
1007983976 6:46188889-46188911 CACCAGCAGCATCACAGAGGGGG + Intergenic
1011227163 6:85120121-85120143 CACCTCTTGCATAACAGTGAAGG - Intergenic
1011743867 6:90389869-90389891 CTCCTCATGCATCACAGTTTGGG - Intergenic
1011879862 6:92011697-92011719 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1017417202 6:154233781-154233803 CAGCACCTGCATCTCACTGTGGG + Intronic
1019426989 7:982612-982634 CACCACCTGCATCTCCCTGAGGG - Intergenic
1020698739 7:11449652-11449674 CATCATCTGTAACACAGTGTAGG + Intronic
1022734565 7:33063434-33063456 CACCACCAGCTCCACAGAGTTGG - Intergenic
1022741916 7:33129804-33129826 CACCACCAGCTCCACAGAGTTGG - Exonic
1023135212 7:37044511-37044533 CACCACCTCAAACACCGTGTTGG - Intronic
1026760325 7:73121743-73121765 CAGCAGCTGCACCACAGGGTTGG + Intergenic
1027036667 7:74930564-74930586 CAGCAGCTGCACCACAGGGTTGG + Intergenic
1027086896 7:75270895-75270917 CAGCAGCTGCACCACAGGGTTGG - Intergenic
1028303229 7:89228715-89228737 CTCCACCTGCACCCCGGTGTGGG - Intronic
1029393194 7:100288893-100288915 CAGCAGCTGCACCACAGGGTTGG - Intergenic
1034066322 7:148140360-148140382 CACACCCTTCATCACATTGTTGG + Intronic
1034137327 7:148783011-148783033 CAGCACCTGCTGCCCAGTGTGGG + Intronic
1035556355 8:569965-569987 CTCCACCCTCATCACAGTCTGGG + Intergenic
1037665402 8:20964735-20964757 TACCACCTGCTGCACACTGTTGG + Intergenic
1042205190 8:66321904-66321926 CACCCCATTCAACACAGTGTTGG + Intergenic
1044853633 8:96452691-96452713 CTCCACCTGCAGCCCAGTATGGG + Intergenic
1047584486 8:126254978-126255000 CTCCACCTCCCTCACAGTATGGG + Intergenic
1047619388 8:126590924-126590946 CACCACATACATCACAGTAATGG - Intergenic
1048799104 8:138179920-138179942 ATCCACCTGCTTCAGAGTGTTGG + Intronic
1049154477 8:141058546-141058568 CAAAGCCTGCATCACAGGGTGGG - Intergenic
1049559861 8:143304549-143304571 CACCCCCAGCAAGACAGTGTTGG - Intronic
1051335617 9:16063366-16063388 CACCTCCTGCTTCTCAGAGTGGG - Intergenic
1051419660 9:16877068-16877090 CTCCACCTGCAGCCCAGTGCGGG - Intergenic
1052576645 9:30299677-30299699 CTCCACCTGCACCCCAGTGTGGG + Intergenic
1052818650 9:33121873-33121895 CACCACAGGGATCACATTGTGGG + Intronic
1053165916 9:35843578-35843600 CAGCAGCTGCATTACACTGTGGG + Intronic
1054914328 9:70481988-70482010 TACCACCTGCTTCATAGTTTGGG + Intergenic
1058120650 9:101135091-101135113 TTGCAACTGCATCACAGTGTGGG + Intronic
1058379501 9:104362850-104362872 CTCCACCTGCGGCCCAGTGTGGG - Intergenic
1058383153 9:104401800-104401822 CTCCAGCTGAATCTCAGTGTTGG + Intergenic
1058886527 9:109325790-109325812 CCACACCTGCAGCACAGTGTGGG - Intergenic
1060918095 9:127403186-127403208 CAGCACCTGCTTCACAGTGCTGG + Intronic
1062631255 9:137464147-137464169 CACCACCGACATCACAGCCTCGG - Exonic
1188870284 X:35363918-35363940 CTTCACCTGACTCACAGTGTAGG - Intergenic
1189227015 X:39421560-39421582 CAGCACCTGCAGCAGAGAGTGGG + Intergenic
1189994005 X:46621544-46621566 TACCACCTGGAGCACAGTGTAGG - Intronic
1192409996 X:70925716-70925738 CACCACCACCATCACAGGGGAGG + Exonic
1198932428 X:141875798-141875820 CACCAGCTGCCTCCCAGTCTAGG + Intronic
1198937775 X:141916813-141916835 CACCAGCTGCCTCCCAGTCTGGG + Intergenic