ID: 967268965

View in Genome Browser
Species Human (GRCh38)
Location 3:187717432-187717454
Sequence ATGTAAATACATATGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 334}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967268965_967268974 8 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268974 3:187717463-187717485 TGCCTTCTTGGGGTCCTAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 127
967268965_967268970 -2 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268970 3:187717453-187717475 ATAACCAACCTGCCTTCTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 110
967268965_967268968 -4 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268968 3:187717451-187717473 ACATAACCAACCTGCCTTCTTGG 0: 1
1: 0
2: 0
3: 10
4: 150
967268965_967268973 7 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268973 3:187717462-187717484 CTGCCTTCTTGGGGTCCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
967268965_967268977 23 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268977 3:187717478-187717500 CTAAAGGGAAAGAAAGACCCAGG 0: 1
1: 1
2: 0
3: 40
4: 347
967268965_967268969 -3 Left 967268965 3:187717432-187717454 CCCAACTCCATATGTATTTACAT 0: 1
1: 0
2: 0
3: 34
4: 334
Right 967268969 3:187717452-187717474 CATAACCAACCTGCCTTCTTGGG 0: 1
1: 0
2: 1
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967268965 Original CRISPR ATGTAAATACATATGGAGTT GGG (reversed) Intronic
900434032 1:2618773-2618795 ATGTAAATACATATTCAAATTGG - Intronic
900816310 1:4849139-4849161 ATATGAATAGATATAGAGTTGGG - Intergenic
902563859 1:17296890-17296912 ATGTTCATATATATGGAGTGAGG - Intergenic
902583577 1:17424615-17424637 ATGTTAATATATTTGGACTTTGG + Intronic
905964089 1:42075536-42075558 ATGTTAGTAGATATGTAGTTTGG + Intergenic
907632884 1:56101702-56101724 ATGTAACTGCATTTGGAGATAGG - Intergenic
907777453 1:57531844-57531866 ATGTCACTAAATATGGAGCTGGG + Intronic
908120822 1:60984418-60984440 ATGTAAGTTCATTTGGAGTTTGG - Intronic
908423744 1:63984713-63984735 ATGAAAATACATATTGAGTCAGG - Intronic
909079814 1:71096541-71096563 ATGTAATGACATTTGGAGATGGG + Intergenic
909150665 1:71999596-71999618 ATGCAAATACATAAGAATTTTGG - Intronic
911494609 1:98615859-98615881 ATATAAATACATATGCATATAGG + Intergenic
912017916 1:105065347-105065369 ATGTACATATTTATGGTGTTAGG + Intergenic
913066190 1:115257626-115257648 ATGTGACTACATTTGGAGATAGG - Intergenic
913210763 1:116580432-116580454 ATGTGACTACATTTGGAGGTAGG + Intronic
916207954 1:162333484-162333506 ATATGAATACACATGGAGTCTGG + Intronic
916843417 1:168624108-168624130 ATGTAAAAGAATATGGAGTGTGG + Intergenic
917463396 1:175252416-175252438 ATTTAAATACATGTGGTGCTAGG - Intergenic
917703550 1:177606335-177606357 ATGTAAATACAACTGGAGATAGG + Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919254519 1:195104460-195104482 ATGTTAATAGATGTGGAATTGGG - Intergenic
921885259 1:220298806-220298828 AGGTAAATACACATGGGGGTGGG + Intergenic
922144041 1:222920176-222920198 ATGTAGATTCATTTAGAGTTTGG + Intronic
922893594 1:229081804-229081826 ATGTAACTATATTTGGAGATAGG + Intergenic
923469900 1:234281136-234281158 ATGTAACTGCATTTGGAGATAGG + Intronic
1064532996 10:16329369-16329391 ATATATATATATATGGAGTCAGG + Intergenic
1064969328 10:21048341-21048363 ATGTAAATACAGATGCAGTCTGG + Intronic
1065148653 10:22799180-22799202 ATGTCACTTCATATGGAGATGGG + Intergenic
1066560638 10:36665913-36665935 ATGTGAATATATTTGGAGATGGG - Intergenic
1067226522 10:44379931-44379953 AAGTAAAAACATTTGGTGTTGGG + Intronic
1068083092 10:52344714-52344736 ATCTAAATAACTATGGATTTAGG - Intergenic
1069151839 10:64971908-64971930 ATGTATATTAATTTGGAGTTGGG + Intergenic
1071978906 10:90983766-90983788 ATGTAAATACCTATGAAGGTGGG + Intergenic
1072401946 10:95111666-95111688 ATTTGAATAGATATGGAGTTGGG - Intergenic
1073232786 10:101986565-101986587 ATATGAAGAAATATGGAGTTTGG - Intronic
1073673866 10:105623080-105623102 AAGTGAATACATGTGGTGTTTGG - Intergenic
1074412534 10:113240895-113240917 ATGTCAATAGTTCTGGAGTTGGG + Intergenic
1074845694 10:117395455-117395477 ATGTGAGTACATATGGTATTTGG - Intergenic
1074902596 10:117831992-117832014 ATGTAGAAAGACATGGAGTTAGG - Intergenic
1074994264 10:118742357-118742379 ATGTGAATACATATGGTCTACGG + Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077999496 11:7482270-7482292 ATGTAATTATATTTGGAGTTAGG - Intergenic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1079664734 11:23090456-23090478 ATGTAATTACAGCTGAAGTTGGG - Intergenic
1082197126 11:49320063-49320085 ATGTAAATAAATTTGTAGTTTGG - Intergenic
1082965010 11:58958232-58958254 CTCCAAATACATTTGGAGTTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084699484 11:70777098-70777120 GTGTAAATGCATATGTAGGTGGG - Intronic
1085725207 11:78949211-78949233 ATGAAAATGCCTATTGAGTTTGG - Intronic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1086658696 11:89388057-89388079 ATGTAAATAAATTTGTAGTTTGG + Intronic
1087692601 11:101338994-101339016 ATGTAAAAATATTTGGATTTGGG + Intergenic
1087973598 11:104516370-104516392 ATACAAATAGATATGGAGTATGG - Intergenic
1088495385 11:110426793-110426815 ATGTATATATATATGGACCTAGG - Intergenic
1089945874 11:122472948-122472970 ATGAAAAGATATCTGGAGTTGGG - Intergenic
1092451464 12:8606228-8606250 ATGTAAACCCATCTGGATTTTGG + Intronic
1093703303 12:22247025-22247047 ATATAAATACAAATGGAGGAAGG - Intronic
1093954757 12:25202893-25202915 GTGTATATACATACGGATTTAGG - Intronic
1094127476 12:27038795-27038817 AAGTCAATGCCTATGGAGTTTGG + Intronic
1095932868 12:47646703-47646725 ATGTGACTACATTTGGAGATAGG - Intergenic
1097444622 12:59654356-59654378 ATATCAATACATATAGTGTTTGG - Intronic
1098058709 12:66537010-66537032 ATGAATATGCATATGGACTTTGG + Intronic
1098718588 12:73865040-73865062 ATGTCAATCCGTATGAAGTTAGG - Intergenic
1099484722 12:83214892-83214914 ATGTAAATAAACATGGGATTTGG - Intergenic
1100781027 12:98026452-98026474 ATGCCAAAACAGATGGAGTTTGG + Intergenic
1101204555 12:102473129-102473151 ATGTAAATAAATATGTCCTTTGG + Intronic
1101861367 12:108485076-108485098 ATGTGACTACATTTGGAGATGGG + Intergenic
1102663027 12:114546182-114546204 ATGTAAATGCATTTGGAGACAGG + Intergenic
1103189786 12:118991460-118991482 TTGTAATTATATATGGATTTGGG + Intronic
1103646381 12:122396704-122396726 AAGTGAATACATATGGAGAGGGG + Intronic
1104169101 12:126262727-126262749 TTCTAAATACAAAAGGAGTTTGG - Intergenic
1105842414 13:24266175-24266197 ATGTAAATATATATGGGTTTTGG + Intronic
1106155393 13:27150588-27150610 TTCTAAATTCATATGGAGGTCGG + Intronic
1106805479 13:33302255-33302277 ATGTAAATAAATACAGAATTTGG + Intronic
1107031367 13:35857411-35857433 ATGATAATTCATAAGGAGTTGGG - Intronic
1108791825 13:53978588-53978610 ATGCAAAGACATATGGAGTGAGG + Intergenic
1109993426 13:70088919-70088941 ATCTATTTACATATGTAGTTTGG + Intronic
1110057969 13:71001470-71001492 ATGTATATACATAAGTATTTGGG - Intergenic
1111438796 13:88249842-88249864 ATTTAAAAATATATGGAATTTGG - Intergenic
1113601336 13:111570749-111570771 GTATATATATATATGGAGTTAGG - Intergenic
1115039028 14:28898463-28898485 ATATAAATACCCAAGGAGTTTGG - Intergenic
1115797092 14:36950305-36950327 ATGTGACTACATTTGGAGATAGG + Intronic
1116259229 14:42601902-42601924 AGGTAAATAGATATAGAGTGGGG - Intergenic
1116779400 14:49219472-49219494 AAGCCAATGCATATGGAGTTGGG - Intergenic
1119142494 14:72280126-72280148 AGGTAAATACCTTTAGAGTTTGG - Intronic
1120046167 14:79808945-79808967 AGGTAAATATTTTTGGAGTTTGG + Intronic
1120064025 14:80018599-80018621 ATGTGAAAACATGTGGTGTTTGG + Intergenic
1120132121 14:80819942-80819964 ATATAATTTCATATGTAGTTTGG - Intronic
1120278427 14:82408371-82408393 ATAAAAATAAATATGGAGCTAGG - Intergenic
1120667103 14:87319067-87319089 ATGTGAATGCATTTGGAGATAGG - Intergenic
1120895777 14:89530579-89530601 ATATATATACATATGGAGAGAGG - Intronic
1123768095 15:23501633-23501655 ATGTAAATACATAGGGTGATGGG + Intergenic
1125118571 15:36124918-36124940 ATGGAAATACATATAGAATATGG - Intergenic
1125180267 15:36874945-36874967 ATATATATATATATGTAGTTGGG + Intergenic
1127916121 15:63456859-63456881 AAGTATAAACATGTGGAGTTTGG - Intergenic
1130646060 15:85728277-85728299 ATGTAAGCACCTAAGGAGTTTGG + Intronic
1130750577 15:86708148-86708170 ATGTAACTACATTTGGAGAGAGG - Intronic
1131330533 15:91495222-91495244 ATGAAGAAACATATGGAGTCAGG + Intergenic
1131638419 15:94262603-94262625 AAATAAATATATAGGGAGTTGGG + Intronic
1132319609 15:100916476-100916498 ATGGAAATATATATAGTGTTAGG + Exonic
1132421890 15:101677042-101677064 AAGTGAGAACATATGGAGTTTGG + Intronic
1133802898 16:9098398-9098420 AAGTAAATACATAAGTAGCTAGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134763234 16:16732735-16732757 ATGTAAGAACATGTGGTGTTTGG + Intergenic
1134888587 16:17818104-17818126 TTGTAAATGCATATGGGGTTAGG + Intergenic
1134982818 16:18626414-18626436 ATGTAAGAACATGTGGTGTTTGG - Intergenic
1135284753 16:21183860-21183882 ATGTGAGAACATATGGTGTTTGG - Intergenic
1138756384 16:59491030-59491052 AAGTAAGAACATATGGCGTTTGG + Intergenic
1141106053 16:81234692-81234714 TTGAAAATACAAATGGAGTCCGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1144212022 17:13023744-13023766 ATGTCACTACATTTGGAGATAGG - Intergenic
1146780017 17:35661378-35661400 ATGAAATTCCAAATGGAGTTAGG + Intronic
1147173649 17:38637078-38637100 ATGTAAATACTAATAGAGTTGGG - Intergenic
1149403172 17:56319830-56319852 ATGTAAATAATTATGAAGTTCGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150537907 17:66063404-66063426 AAGTAAAAACATATGGTATTTGG - Intronic
1153109137 18:1562642-1562664 ATGTAAGTAAATATGGAATGTGG - Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156915342 18:42459902-42459924 AGGTATATACATATGCACTTAGG + Intergenic
1158531317 18:58264930-58264952 ATATAAATACTTAGGGAGCTTGG + Intronic
1158918101 18:62157162-62157184 AAGTAAATACACATGGAGCTGGG - Exonic
1166413147 19:42570374-42570396 AATTAAACACATATGGACTTTGG - Intergenic
1166427767 19:42694899-42694921 AAGCAAATACATCTGGATTTTGG - Intronic
1167053711 19:47095623-47095645 ATGTAAATATCTATGGGGTGGGG + Intronic
925311983 2:2891132-2891154 ATGTAAGCACATCTGGAGGTAGG + Intergenic
925651032 2:6089477-6089499 GTGTCAATACATATGCAGTAGGG - Intergenic
925728298 2:6895897-6895919 AGGAAAATACATATGGAGTAAGG + Exonic
925892693 2:8448618-8448640 ATGAAAACACACTTGGAGTTTGG + Intergenic
926468517 2:13222515-13222537 AAGTAAATACATAGGAAGTTTGG - Intergenic
926515032 2:13832885-13832907 AAGTAAGAACATATGGTGTTTGG - Intergenic
927752236 2:25679570-25679592 ATGTAACTATATTTGGAGATAGG - Intergenic
928303242 2:30145838-30145860 ATGAAAATACTTGTGGATTTGGG + Intergenic
930661910 2:54063316-54063338 ATATAGATACATATAGAGTTAGG + Intronic
931192664 2:60020678-60020700 ATATCACTAAATATGGAGTTGGG + Intergenic
932033879 2:68220463-68220485 TTGTAAATACACAGGGAATTGGG + Intronic
933683331 2:85122814-85122836 ATGTGAGTACATTTGGAGATAGG - Intergenic
933844960 2:86318111-86318133 ATATTAATGCATATGGATTTTGG + Intronic
935664937 2:105502970-105502992 ATGAAAATACAAATGGGGTAGGG - Intergenic
935903190 2:107814586-107814608 ATGTAATTACATTTAGAGATAGG + Intergenic
937744314 2:125393173-125393195 ATGCAAACACATATGAAGGTTGG + Intergenic
939773048 2:146348478-146348500 ATGTATGTACATATGTACTTTGG - Intergenic
939872720 2:147542909-147542931 GTGAAAATACAAATGCAGTTTGG - Intergenic
939949271 2:148449273-148449295 TTGAAAATACATAAGGAGGTGGG - Intronic
940194778 2:151081537-151081559 ACGTAAAAACAAATGAAGTTTGG + Intergenic
941597743 2:167498869-167498891 ATTTAAATTCATATGAAGTTAGG - Intergenic
942987537 2:182161149-182161171 ATGTATATGCATCTGGAGCTGGG - Intronic
944788565 2:203099979-203100001 ATGTAAAAACATGTGGTATTTGG + Intronic
945619291 2:212113107-212113129 ATGAAAATACAGATCGAATTTGG + Intronic
947130791 2:226922501-226922523 ATGAAAATACATATAGAGGCTGG - Intronic
947280608 2:228449266-228449288 AGGTAGATATATATGCAGTTAGG - Intergenic
947396502 2:229692641-229692663 ATGTAAATAAAAATGGTTTTGGG + Intronic
948099522 2:235362509-235362531 ATGTAAATTTATATAGAGATGGG + Intergenic
948318364 2:237047896-237047918 ATGTAACTGCATTTGGAGATAGG + Intergenic
1169897573 20:10520745-10520767 ATGTTCATACAGATGGTGTTGGG - Intronic
1170328300 20:15180156-15180178 ATATAAATGTATATGGAGATAGG - Intronic
1170493164 20:16898836-16898858 ATGTTTATATAAATGGAGTTGGG - Intergenic
1171053642 20:21884931-21884953 ATGTGACTGCATTTGGAGTTAGG - Intergenic
1172697216 20:36831171-36831193 ATGTACATAGAGATGGAGTCTGG - Intronic
1173055357 20:39606884-39606906 GTGAAAATACATTTGTAGTTTGG - Intergenic
1173311462 20:41899819-41899841 ATGTAGATACACATGGTGCTGGG + Intergenic
1173573428 20:44093568-44093590 ATATAAATATATTTGGAGATAGG - Intergenic
1173633463 20:44533905-44533927 GGGTAAATAAATATGGAGGTCGG + Intronic
1177500993 21:21955002-21955024 ATGTCACTAAATGTGGAGTTGGG - Intergenic
1177876405 21:26637259-26637281 ATGCAAATAGCTATGGATTTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179652173 21:42818607-42818629 ATGTGACTACATTTGGAGATGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182207379 22:28642629-28642651 ATGCAGATACATATGGAATTAGG + Intronic
1182230915 22:28836950-28836972 AAGAAAATAAAGATGGAGTTGGG - Intergenic
1182718995 22:32382797-32382819 AAGTAAATACATTTGGAGTGGGG - Intergenic
1183424413 22:37731443-37731465 ATATATATATATATGGGGTTGGG - Intronic
1183738318 22:39656115-39656137 ATGTAATTACAGATGGAAATGGG + Intronic
1184931485 22:47684435-47684457 ATGTGACTACATTTGGAGATAGG + Intergenic
949817419 3:8073216-8073238 ATGTGAAAACATATGGTGTTTGG - Intergenic
950823389 3:15787612-15787634 ATGTACACACATATGGTTTTAGG + Intronic
951116825 3:18873056-18873078 ATACAAATACATTTGGGGTTTGG + Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952161713 3:30700427-30700449 ATGGAAATACATAAAGATTTAGG - Intergenic
952446139 3:33382877-33382899 ATGTAGATGCAGATGGAATTGGG - Intronic
953009239 3:39008591-39008613 ATCTAAATATATTTGGAGCTGGG + Intergenic
953818844 3:46186651-46186673 ATGACATAACATATGGAGTTGGG + Intronic
955251173 3:57284130-57284152 ATGTAAATATATATATATTTAGG + Intronic
957176206 3:76813162-76813184 ATGTAAATACACTTGGAGAGAGG - Intronic
958155819 3:89754515-89754537 GTGTAAGTACATATGTAGGTAGG - Intergenic
959137239 3:102438660-102438682 ATTTAAATATATATGGAGAACGG + Intronic
959681198 3:109098500-109098522 CTGGAGATGCATATGGAGTTTGG - Intronic
959833107 3:110888648-110888670 ATGTAAATATAGATATAGTTTGG + Intronic
960569471 3:119171419-119171441 ATGAACATACACAGGGAGTTGGG + Intronic
961137576 3:124526276-124526298 ATAAAAATACATATGGAGCCAGG + Intronic
961481821 3:127185286-127185308 ATGTTAATACTTGTGGAATTTGG - Intergenic
963470027 3:145728771-145728793 ATGTAGCTACATATAGAGATAGG - Intergenic
964717034 3:159733338-159733360 ATGTATATACAGCTGGGGTTGGG + Intronic
964895942 3:161595387-161595409 ATGGAAATACAAATGGGGATTGG - Intergenic
965190031 3:165516078-165516100 ATGAAAATAAATAGGGAGATGGG - Intergenic
965945593 3:174237535-174237557 ATGTAAATAAATATTTGGTTAGG + Intronic
966023422 3:175244280-175244302 ATGGTAATATATATGGAGTAAGG + Intronic
966622418 3:181980315-181980337 ATGTGACTACATTTGGAGATAGG + Intergenic
967268965 3:187717432-187717454 ATGTAAATACATATGGAGTTGGG - Intronic
967358394 3:188600119-188600141 ATGTACATACACATGGACATTGG + Intronic
967696339 3:192536021-192536043 ATGTAAGTACATATTGTATTAGG - Intronic
970425227 4:15939723-15939745 ATATAAACACATCTGGATTTGGG - Intergenic
970429888 4:15978909-15978931 ATGTAAATTCATAAAGATTTCGG + Intronic
970793130 4:19882606-19882628 ATGTGACTATATATGGAGATAGG - Intergenic
970928063 4:21476351-21476373 ATGTGACTAAATGTGGAGTTAGG + Intronic
970976036 4:22044175-22044197 ATGTCATTGAATATGGAGTTAGG - Intergenic
971687726 4:29790175-29790197 ATGTAAAAAGACATGGAATTAGG + Intergenic
971772906 4:30921871-30921893 ATGTAATTACATATGTAATTTGG + Intronic
971829895 4:31677731-31677753 TGGTAAATAAATATGGATTTTGG + Intergenic
972000524 4:34026395-34026417 ATATACATACATATGGATTTAGG + Intergenic
972462666 4:39319742-39319764 ATGTAAGTATATATATAGTTTGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974213013 4:58807267-58807289 ATGTCAAGACTTATGGAGATGGG + Intergenic
974521761 4:62989898-62989920 ATGTATATACATGTGGACTAAGG - Intergenic
974890883 4:67880948-67880970 TTGTAAATAAAAATGGACTTTGG - Intronic
975680523 4:76871017-76871039 ATGTGAAAACATGTGGTGTTTGG - Intergenic
975782154 4:77850472-77850494 AAATAAATAAATATAGAGTTGGG + Intergenic
975998605 4:80344528-80344550 GTGTAAATACATCTGGTCTTGGG - Intronic
976499803 4:85774580-85774602 ATGTAATCACATATCTAGTTAGG + Intronic
978428169 4:108603992-108604014 AAGTAAATACATAATGAATTTGG + Intergenic
979014136 4:115410724-115410746 ATGTACATACATATGTAATATGG + Intergenic
979099382 4:116596780-116596802 ATGTAACTAGATTTGGAGATGGG + Intergenic
979987146 4:127329272-127329294 ATGTAAATATATTTGGAGAGAGG + Intergenic
980157997 4:129129901-129129923 AAGGAAATACAGATGGACTTAGG + Intergenic
980403906 4:132331486-132331508 ATGTAAATATATTTAGAGATAGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
982143085 4:152348467-152348489 ATGGAAATAAATATGCTGTTTGG + Intronic
982185509 4:152793521-152793543 AACTTAGTACATATGGAGTTTGG - Intronic
983447652 4:167875337-167875359 ATAAAAATACATATGGAGCAGGG - Intergenic
983774603 4:171591673-171591695 ATGTAAATTCATCTGGACCTGGG + Intergenic
983779989 4:171657103-171657125 ATGTATATACATATGTATATAGG - Intergenic
984107817 4:175572332-175572354 ACATAAATACTTATGGAGGTAGG + Intergenic
984665264 4:182420204-182420226 ATGGATATACATTTGGTGTTTGG + Intronic
985147830 4:186912515-186912537 ATGAAACTACATATGTATTTAGG + Intergenic
987579021 5:19764478-19764500 ATATAAACACATATAAAGTTAGG + Intronic
987695542 5:21325066-21325088 ATTTAAATACAAATGTATTTTGG - Intergenic
987805063 5:22753730-22753752 ATGTATATACATTTGCGGTTGGG + Intronic
988032748 5:25785011-25785033 GGTTAAATACATATGGAATTGGG - Intergenic
989016293 5:36938703-36938725 ATGTAAATCCATAGGAAGTTGGG + Intronic
989212675 5:38871677-38871699 ATGTACATACAGATAGAGATAGG + Intronic
990294897 5:54391088-54391110 GTGTAAACCCATATGGAGTCTGG - Intergenic
991173224 5:63653239-63653261 ATGTGACTACATTTGGAGATAGG - Intergenic
991552815 5:67860826-67860848 ATGTAAGAACATATGGTATTTGG - Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
991744862 5:69727033-69727055 ATTTAAATACAAATGTATTTTGG + Intergenic
991752843 5:69828193-69828215 ATTTAAATACAAATGTATTTTGG - Intergenic
991796432 5:70306761-70306783 ATTTAAATACAAATGTATTTTGG + Intergenic
991802461 5:70384927-70384949 ATTTAAATACAAATGTATTTTGG - Intergenic
991824242 5:70602347-70602369 ATTTAAATACAAATGTATTTTGG + Intergenic
991832162 5:70703321-70703343 ATTTAAATACAAATGTATTTTGG - Intergenic
991888810 5:71306317-71306339 ATTTAAATACAAATGTATTTTGG + Intergenic
992817725 5:80462060-80462082 ATGTAACTGTATTTGGAGTTGGG - Intronic
992832930 5:80612814-80612836 ATATATATATATATGGAGTGGGG + Intergenic
993498882 5:88640813-88640835 ATGTAACTGCATTTGGAGATAGG + Intergenic
993821089 5:92617710-92617732 AAGTAAATACATGTGGTGTTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995168745 5:109080651-109080673 AAGTAAATGGATATGGACTTGGG + Intronic
995901160 5:117068034-117068056 ATGTATGTACATATGTATTTTGG - Intergenic
996490031 5:124083934-124083956 ATGTATGTAAATCTGGAGTTTGG - Intergenic
997490427 5:134271259-134271281 ATGTAATTATCTATGTAGTTGGG + Intergenic
997645743 5:135480794-135480816 ATGTAAAGTCAGATGGTGTTGGG - Intergenic
998399371 5:141840454-141840476 ATAAAAATAGAGATGGAGTTGGG + Intergenic
1000049404 5:157548916-157548938 ATGGATATACATTTGGATTTGGG - Intronic
1000130636 5:158294457-158294479 ATATAAATACATATAGATTGGGG - Intergenic
1000614534 5:163412763-163412785 ATGTAAATTCATATGAAACTAGG - Intergenic
1001897435 5:175393440-175393462 ATATAAATACATATATAATTTGG + Intergenic
1003334440 6:5157295-5157317 ATGTAAATAAATAAGGACTTAGG + Intronic
1005007482 6:21302873-21302895 CAGTAAATACATTTGGAATTGGG - Intergenic
1005112024 6:22293021-22293043 ATGTAAATACATTTGCACTGTGG - Intronic
1005555240 6:26973036-26973058 ATTTAAATACAAATGTATTTTGG + Intergenic
1006233550 6:32607045-32607067 ATGAAAATACAAATGGGGTTTGG + Intergenic
1008097152 6:47350788-47350810 CTGTAAATAGATAAGGAGTGGGG - Intergenic
1008112989 6:47513425-47513447 ATGCAAAAACCTATGCAGTTTGG - Intronic
1009461959 6:63924113-63924135 ATGTAAAATCATATGCAGTGAGG - Intronic
1010072278 6:71757800-71757822 ATGTCACTAAACATGGAGTTGGG + Intergenic
1010103695 6:72142838-72142860 ACGATAATACATATGGACTTAGG + Intronic
1010761513 6:79728650-79728672 ATTCAAATACATATGGATCTTGG + Intergenic
1011330486 6:86199797-86199819 TTAGAAATACATATGGATTTGGG - Intergenic
1011811941 6:91142235-91142257 TTGAAAATACACATGGAGGTCGG + Intergenic
1012237248 6:96833239-96833261 ATGTGGATACAAAGGGAGTTGGG - Intronic
1012726144 6:102813276-102813298 ATATATATATATATGTAGTTTGG + Intergenic
1012738828 6:102987463-102987485 ATGTATATACAAATGTATTTTGG + Intergenic
1012973671 6:105757180-105757202 ATGTAAATGCACACTGAGTTAGG - Intergenic
1013165985 6:107592532-107592554 ATGTAAATTCATGTTGAGCTGGG - Intronic
1013174662 6:107667237-107667259 ATGGAAAAACATTTGGAGGTTGG - Intergenic
1014179363 6:118367826-118367848 ATGTTAAGACATTTAGAGTTTGG - Intergenic
1014294234 6:119598939-119598961 ATGTAAATGCATTTGGAGATAGG + Intergenic
1014585303 6:123190812-123190834 ATGTAATTACATTTGTAGATAGG + Intergenic
1014720147 6:124906929-124906951 AAATAAATACATATAGAGTGAGG - Intergenic
1015141455 6:129938466-129938488 ATGTAAATACATACAGAGGGAGG - Intergenic
1016488551 6:144570510-144570532 AAGTAAAAAAATATGGATTTTGG - Intronic
1017082232 6:150681006-150681028 TTGTAAATTCATATAGAATTTGG - Intronic
1017988415 6:159465117-159465139 ATTTACATACATATGGAGCCTGG - Intergenic
1018022663 6:159776515-159776537 TTGTACATAAATATTGAGTTGGG - Intronic
1018269592 6:162062484-162062506 ATGTGAATGCATTTGGAGATAGG + Intronic
1019089373 6:169514513-169514535 ATATAAATATATATATAGTTGGG - Intronic
1020998449 7:15295844-15295866 ATGTTAATAAATTTGGAATTGGG + Intronic
1021611800 7:22464940-22464962 ATATATATATATATGGGGTTTGG - Intronic
1021695820 7:23275383-23275405 ATATATATATATATGTAGTTAGG - Intergenic
1024583452 7:50820246-50820268 ATGTGAATACTTATGGTTTTGGG + Intergenic
1024777414 7:52803612-52803634 ATCTAAATACAAAGGGAGTGTGG + Intergenic
1027396579 7:77761562-77761584 ATGTAAATACTTCTTGATTTTGG - Intronic
1030979446 7:116169093-116169115 ATGTCAGTGAATATGGAGTTTGG - Intergenic
1031718467 7:125137926-125137948 ATGCAAAAACATATTGATTTAGG + Intergenic
1031795031 7:126162365-126162387 ATGTACATATATATGGGGTATGG + Intergenic
1031897531 7:127368687-127368709 TGGTAAATACATGTGGAGATAGG - Intronic
1033450730 7:141460432-141460454 ATGTGACTACATTTGGAGATTGG - Intronic
1033790954 7:144791789-144791811 ATGTAAATGAAAATGGATTTTGG - Intronic
1035733234 8:1867470-1867492 ATGTACATAAAAATAGAGTTTGG - Intronic
1036459808 8:8942112-8942134 ATGGAAATACTTTTGGAGATAGG + Intergenic
1037288676 8:17327964-17327986 ATGAAAATACTTATGAAGTGTGG + Intronic
1038731996 8:30136185-30136207 ATGTGACTGTATATGGAGTTAGG + Intronic
1039147362 8:34463924-34463946 ATGTTACTGCAAATGGAGTTTGG - Intergenic
1040503549 8:48026374-48026396 ATGTAAATGAATATTGAGTTTGG + Intronic
1040767486 8:50931183-50931205 ATGCAAATACATACAGCGTTTGG - Intergenic
1040862974 8:52020109-52020131 ATGTGAATAAATGTAGAGTTGGG - Intergenic
1042817103 8:72889755-72889777 ATATATATATAAATGGAGTTTGG - Intronic
1044091954 8:88012859-88012881 ATGCAAATACATTTGGATATGGG - Intergenic
1044212100 8:89562047-89562069 ATGAAAATACACATGATGTTGGG - Intergenic
1045209910 8:100086467-100086489 AAGTGAAAACATATGGTGTTTGG - Intronic
1045519402 8:102890417-102890439 ATGTAAATATATGTGTATTTAGG - Intronic
1045829304 8:106439159-106439181 ATGAAATGACATTTGGAGTTGGG + Intronic
1046174836 8:110561722-110561744 AAGTAAAAACATGTGGTGTTTGG - Intergenic
1046776991 8:118174785-118174807 ATGTTAATACTGATGGATTTGGG - Intergenic
1047122832 8:121925609-121925631 GTCTAAATACATATTGAGATAGG - Intergenic
1047143682 8:122172380-122172402 ATGTAAATACTTATGTACATAGG + Intergenic
1047177505 8:122555465-122555487 CTGTAAATACAAAGGGAGATTGG - Intergenic
1047963132 8:130025357-130025379 ATGTAATAACATAGGGAGTCTGG - Intergenic
1048259191 8:132931290-132931312 ATGTGACTGCATTTGGAGTTAGG - Intronic
1050842065 9:10162755-10162777 ATATAAATATATATGGAGCTGGG + Intronic
1051219153 9:14830551-14830573 ATGTAAAGACATATCAACTTAGG + Intronic
1051972034 9:22900091-22900113 ATGGAAAAACATATAGAGCTGGG - Intergenic
1052676325 9:31629890-31629912 ATTTATATAAATCTGGAGTTTGG + Intergenic
1052882273 9:33609242-33609264 ATGTAAATGCTTATGGTCTTTGG - Intergenic
1053612038 9:39723965-39723987 ATGTCCATACACATGGACTTAGG + Intergenic
1053870072 9:42481957-42481979 ATGTCCATACACATGGACTTAGG + Intergenic
1054086218 9:60747191-60747213 ATGTCCATACACATGGACTTAGG - Intergenic
1054241480 9:62618428-62618450 ATGTCCATACACATGGACTTAGG - Intergenic
1054555608 9:66652951-66652973 ATGTCCATACACATGGACTTAGG - Intergenic
1054722316 9:68616423-68616445 ATATAAATATTTATGGATTTAGG + Intergenic
1057238637 9:93388606-93388628 CTGTAAAGACATATGATGTTGGG + Intergenic
1057832430 9:98417526-98417548 TTATGAATACACATGGAGTTGGG - Intronic
1057923999 9:99126631-99126653 ATGTAAATACATATAACATTTGG + Intronic
1059208885 9:112492544-112492566 ATGTATGTACATATGTAGGTAGG - Intronic
1059864829 9:118502656-118502678 ATGTGTATACATATGGACGTAGG - Intergenic
1061567046 9:131447842-131447864 TGGTAAGTACATATGGACTTTGG - Intronic
1185654818 X:1676451-1676473 ATGTAAACACACATGTAGATAGG - Intergenic
1185981235 X:4782086-4782108 ATATCACTACATATGGAGTGAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186850431 X:13574529-13574551 ATATAATTACATTTGGAGATAGG + Intronic
1188502835 X:30847755-30847777 ATCTTAATTCATATGGTGTTAGG + Intronic
1188757574 X:33982719-33982741 ATGTAAATATATATGCTGCTTGG + Intergenic
1189739398 X:44102702-44102724 ATTTAATTACATATGTAGATGGG - Intergenic
1190039763 X:47060944-47060966 ATGGCATTACATATGGAATTTGG - Exonic
1190394214 X:49963423-49963445 ATGTACACACATATGGATTGGGG - Intronic
1193458329 X:81758339-81758361 CTGTAAATCCATCTGGTGTTGGG - Intergenic
1193646588 X:84077478-84077500 ATATAAATACAAATGCAATTTGG + Intronic
1194168746 X:90555652-90555674 AAGTAAAAACATATGGTATTTGG + Intergenic
1194868970 X:99103346-99103368 ATGTAAAGACATATGATGTTTGG + Intergenic
1195477007 X:105298592-105298614 ATATATATGAATATGGAGTTTGG + Intronic
1195794329 X:108627384-108627406 ATATATATGCATATAGAGTTTGG + Intronic
1197673851 X:129308899-129308921 TTGTAAATACATGTACAGTTGGG + Intergenic
1198205180 X:134459232-134459254 ATGTATATATATATGCACTTAGG - Intergenic
1199146074 X:144368685-144368707 TTCTAAATATATATGGAATTTGG - Intergenic
1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG + Intergenic
1199800269 X:151243806-151243828 ATATATATACATATGAAGCTAGG - Intergenic
1199817649 X:151412929-151412951 ATGTGACTATATATGGAGATAGG - Intergenic
1200514986 Y:4133440-4133462 AAGTAAAAACATATGGTATTTGG + Intergenic
1201926089 Y:19289560-19289582 ATATATATATATATGGACTTAGG + Intergenic
1202580770 Y:26378238-26378260 ATGGATATTGATATGGAGTTGGG - Intergenic