ID: 967269182

View in Genome Browser
Species Human (GRCh38)
Location 3:187718968-187718990
Sequence CACCTTTAGCTGCGGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967269175_967269182 4 Left 967269175 3:187718941-187718963 CCACTGTGCGAACTCAGCCTACC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG 0: 1
1: 0
2: 0
3: 24
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967269182 Original CRISPR CACCTTTAGCTGCGGGACCT TGG Intronic
900159537 1:1216985-1217007 CAGCGGCAGCTGCGGGACCTGGG + Exonic
900378638 1:2372973-2372995 CACCCTGAGGTGCTGGACCTGGG + Intronic
902775678 1:18673140-18673162 CACATATAGCTGTGTGACCTTGG + Intronic
902795747 1:18799595-18799617 CACCTCCTGCTGCGGGCCCTGGG + Intergenic
903582806 1:24384873-24384895 CACTTACAGCAGCGGGACCTTGG - Intronic
904249625 1:29213731-29213753 CACTTTTGGCTGGGTGACCTTGG + Intronic
904317256 1:29673482-29673504 CATCTTGAGCTGTGTGACCTTGG + Intergenic
904424394 1:30414216-30414238 GACATGTGGCTGCGGGACCTGGG + Intergenic
905879598 1:41454923-41454945 CACCTCTAGCTGTGTGACCTTGG + Intergenic
906704807 1:47887273-47887295 CACTTATAGCTGTGTGACCTTGG - Intronic
907516883 1:54998457-54998479 CATCTTTAGCTGTGTGACCTTGG + Intergenic
907734624 1:57100110-57100132 CACCACTAGCTACGGGATCTTGG + Intronic
909325451 1:74346397-74346419 CATTTTTAGCTGCAGGACCTCGG - Intronic
915354361 1:155247326-155247348 CACCTCTAGCTGCATGACCTTGG - Exonic
920216054 1:204362117-204362139 TGCCTTTAGCTGGGGGACCAAGG + Intronic
923077069 1:230619230-230619252 CACCATTAGCTGAGGCAGCTTGG - Intergenic
923413994 1:233736877-233736899 CACTTTTATCTGTGTGACCTTGG + Intergenic
1069747304 10:70723937-70723959 CACTTCTAGCTGCGTGGCCTTGG + Intronic
1069920603 10:71813239-71813261 CACCTTCAGCAGCGAGCCCTGGG - Exonic
1070388409 10:75947582-75947604 CCCTTTTAGCTGGGTGACCTTGG + Intronic
1070750315 10:78960215-78960237 GCCCTTTTGCTGCGTGACCTTGG + Intergenic
1079389742 11:20011593-20011615 CACTTTTAGCTGTGTGACTTTGG - Intronic
1080040389 11:27753918-27753940 CACCATGAGCTGCATGACCTTGG - Intergenic
1081702192 11:45159020-45159042 CACCGGTAGCTGAGGGAACTGGG - Intronic
1083267207 11:61552157-61552179 TTCCTTTAGCTGGAGGACCTGGG - Intronic
1083898920 11:65634382-65634404 CACCTGGGGCTGTGGGACCTGGG + Intronic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089196222 11:116695373-116695395 CACCTTTAGGTGCTGGGCCGTGG - Intergenic
1089283102 11:117388126-117388148 CACCTTAAGGTGCAGCACCTTGG + Intronic
1090211575 11:124924387-124924409 CACTTCTAGCTGTGTGACCTTGG + Intronic
1095484767 12:42673553-42673575 CACATTTACCTGAGCGACCTAGG - Intergenic
1100431275 12:94533843-94533865 CAGCTCTAGCTGTGGAACCTTGG + Intergenic
1101590984 12:106125133-106125155 CAACTTAAGCTGTGTGACCTTGG - Intronic
1102415553 12:112759538-112759560 CACCTTAAGCTGTGCAACCTTGG - Intronic
1112505339 13:99971434-99971456 CACCTCCGCCTGCGGGACCTGGG - Exonic
1117591174 14:57269477-57269499 CACGAATAGCTGCGTGACCTTGG + Intronic
1119557004 14:75560984-75561006 CACGTTTAACTGTGTGACCTTGG - Intergenic
1121040328 14:90741065-90741087 CCCCTTTAGCTGTGGGACTTTGG - Intronic
1121437250 14:93927911-93927933 CACCTGTAGCTGGGTCACCTTGG + Intronic
1121966353 14:98310153-98310175 CAACTTTATCTGTGTGACCTTGG - Intergenic
1122347453 14:101069388-101069410 CACCTCCAGCTGGGTGACCTTGG - Intergenic
1122868250 14:104620040-104620062 CACCTTTTCCTACAGGACCTGGG - Intergenic
1125394960 15:39236575-39236597 CACTTTTAGTTGGGTGACCTTGG + Intergenic
1129712973 15:77830539-77830561 GACCTTGAGATGCTGGACCTTGG - Intergenic
1132315950 15:100890651-100890673 CACCTCTGGCTGGGTGACCTAGG - Intronic
1132853836 16:2036140-2036162 GAGCTTTAGCTGTGGGAACTTGG - Intronic
1133998675 16:10766196-10766218 CACCACTAGCTGTGGGACTTGGG + Intronic
1134104411 16:11475777-11475799 CACCTTGAGCTGCCAGAGCTTGG + Intronic
1135166238 16:20141563-20141585 TCCCTTGAGCTGCAGGACCTGGG - Intergenic
1135618317 16:23931253-23931275 CACCTTTAGCTCCAGAATCTTGG - Intronic
1136395295 16:29989056-29989078 CTCCCTGAGCTGCTGGACCTGGG + Intronic
1136621152 16:31429254-31429276 CTCCTGCAGCTGGGGGACCTAGG - Intergenic
1138589390 16:57991478-57991500 CTCCTTAGGCTGGGGGACCTAGG + Intergenic
1140759853 16:78100630-78100652 CATCTTTAACTGTGTGACCTTGG + Intronic
1141675526 16:85515424-85515446 CTTCTTTAGCTTCGGGGCCTGGG + Intergenic
1141826815 16:86486417-86486439 CACCTGTTGCTGCGTGACCTGGG + Intergenic
1143990171 17:10952391-10952413 CCCCTTTAGCTGTCTGACCTTGG + Intergenic
1144073102 17:11692188-11692210 CACTTGCAGCTGTGGGACCTTGG + Intronic
1144180147 17:12744223-12744245 CACCTTTGGCTTGGGGTCCTTGG - Exonic
1144753730 17:17667400-17667422 CACCTGTTGCTGTGTGACCTTGG - Intergenic
1145069477 17:19791287-19791309 CACCTGTAGCTGCAGCACTTCGG + Intronic
1145976655 17:28987838-28987860 CATCATTAGCTGCGTGACCTTGG - Intronic
1147500163 17:40955561-40955583 CATCTCCAGCTGTGGGACCTGGG - Intergenic
1147986510 17:44310184-44310206 CAGCTTTAGCTGCGCCACCTTGG + Intronic
1148322309 17:46764869-46764891 CACCTCTAGCTGAGGGCCTTGGG + Intronic
1148491674 17:48027447-48027469 CACCTAAAGCTGGGTGACCTAGG - Intronic
1154193764 18:12251579-12251601 CTCCTCTAGCTGGGTGACCTTGG - Intergenic
1156336187 18:36173946-36173968 GACCTCTAACTGCGTGACCTTGG - Intronic
1157183755 18:45520718-45520740 CACATCTAGCTGTGTGACCTAGG + Intronic
1163443938 19:17335659-17335681 CACATTTAGCTGGGCGACCTGGG + Intronic
1165437543 19:35804541-35804563 CACCTCTAGCTGTGTGACCTGGG - Intronic
1165464312 19:35963761-35963783 CACACTGTGCTGCGGGACCTGGG + Intergenic
1166044181 19:40219814-40219836 CCTCCTTAGCTGTGGGACCTGGG + Intergenic
1167043606 19:47037469-47037491 CACTTATAGCTGTGTGACCTGGG - Intronic
926226092 2:10967874-10967896 TTCCTTTAGCTGAGTGACCTTGG - Intergenic
926910806 2:17851069-17851091 CACCATTAGCTGTGTGACCTTGG + Intergenic
935156103 2:100484933-100484955 TACTTTTAGCTGGGTGACCTTGG + Intergenic
935524113 2:104144644-104144666 CTACTCTAGCTGTGGGACCTTGG - Intergenic
936252947 2:110881868-110881890 CCCCTTTACCTGAGGGACATTGG + Intronic
936958605 2:118049336-118049358 CACTATTAGCTGTGTGACCTTGG - Intergenic
937243144 2:120475425-120475447 CACCATCAGCTGTGTGACCTGGG - Intergenic
941460364 2:165763861-165763883 TACTTTTAGCTGTGTGACCTTGG + Intronic
946840335 2:223813527-223813549 CACTTATAGCTGTGTGACCTTGG - Intronic
948087559 2:235264276-235264298 CATCTTTAGCTGTGTGACCCTGG - Intergenic
1168890743 20:1294158-1294180 CACCTGCAGCTGTGTGACCTTGG + Intronic
1174277648 20:49415471-49415493 CCCCTTTAAGTGCTGGACCTGGG + Intronic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1177863478 21:26483801-26483823 CAACTATAGCTGTGGAACCTTGG + Intronic
1180250451 21:46582664-46582686 CACCTTCAGCTGAGGTACCCAGG - Intergenic
1182267587 22:29130220-29130242 GATCTTTATCTGTGGGACCTTGG - Intronic
1182518948 22:30874560-30874582 CACCACTAGCTGTGGGTCCTGGG - Intronic
1182782229 22:32877365-32877387 CACCAATAGCTGCGTGACCTTGG - Intronic
1183479230 22:38053890-38053912 CTCTTTTAGCTGGAGGACCTTGG - Intergenic
1184636199 22:45833925-45833947 CACATCCAGTTGCGGGACCTTGG + Intronic
950655748 3:14435194-14435216 GTCCTGTAGCTGTGGGACCTGGG + Intronic
954708824 3:52495107-52495129 CACCATGAGCCCCGGGACCTGGG - Intergenic
959999839 3:112719439-112719461 TACCTTTTGCTGTGTGACCTTGG + Intergenic
967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG + Intronic
969490393 4:7496301-7496323 CAGCTTGAGCAGCCGGACCTTGG - Intronic
970099527 4:12504554-12504576 CACTTCTAGCTGTGTGACCTTGG - Intergenic
971246295 4:24931515-24931537 CATCTTTAGCTGCAACACCTGGG + Intronic
972378073 4:38492025-38492047 CAACATTAGCTGTGTGACCTTGG - Intergenic
974979358 4:68935451-68935473 GACCTGAAGCTGAGGGACCTGGG + Intronic
975608050 4:76175562-76175584 CACTTATAGCTGTGTGACCTTGG - Intronic
988670473 5:33375900-33375922 CATCATTAGCTGTGTGACCTGGG - Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991986514 5:72292573-72292595 CACCCTGAGCTGCTGGAACTTGG + Intronic
992321773 5:75620601-75620623 CCCCTTTACCTATGGGACCTGGG + Intronic
992668596 5:79036042-79036064 CACTGTTAGCTGGGTGACCTTGG + Intronic
992895379 5:81240679-81240701 TCCCTTTAGCTGTGTGACCTTGG + Intronic
993493874 5:88586248-88586270 CACCTTCAGCTGAGATACCTGGG + Intergenic
993618684 5:90142972-90142994 CATCTTTAGCTCCTGGACCTTGG - Intergenic
993653783 5:90553888-90553910 CACCTCTACCTGTAGGACCTGGG - Intronic
994635488 5:102340567-102340589 CACCTTTACCTGTTGGATCTAGG - Intergenic
997658922 5:135575431-135575453 CAAATTTGGCTGTGGGACCTTGG + Intronic
997887202 5:137640661-137640683 CACTCTTAGCTGTGTGACCTTGG - Intronic
999197130 5:149790023-149790045 CACTTCTAGCTGGGTGACCTTGG + Intronic
999306806 5:150525015-150525037 CACCATTACCTGGGGGACCTTGG - Intronic
1000260518 5:159584118-159584140 CACCTTTAGATGTGTTACCTTGG - Intergenic
1001253742 5:170168038-170168060 CACCTTCAGCGGTGTGACCTTGG - Intergenic
1001822606 5:174721502-174721524 CACTTCTACCTGCGCGACCTTGG + Intergenic
1002392267 5:178924398-178924420 CACTATTAGCTGTGTGACCTTGG - Intronic
1004266582 6:14153304-14153326 CACCTTTAGCTGCAGTAACTGGG - Intergenic
1006511168 6:34521996-34522018 CACCTGTAGCTGCGCGATCTTGG + Intronic
1007458479 6:41999087-41999109 CACTTCTAGCTGTGGGACCTTGG - Intronic
1015824504 6:137297236-137297258 CAGATTTAGCTGTGTGACCTAGG + Intergenic
1015833773 6:137397624-137397646 CACCTTCAGTGGCAGGACCTAGG - Intergenic
1015938550 6:138426288-138426310 CACCTCTCGCTGTGTGACCTGGG + Intronic
1018624095 6:165760794-165760816 CACCATCAGCTGTGGGGCCTGGG - Intronic
1019580706 7:1760662-1760684 CACCTGCAGCTATGGGACCTGGG + Intergenic
1019612982 7:1946212-1946234 CACCTCTAGCTGCAGGCCCAGGG + Intronic
1020103166 7:5406998-5407020 CACCTCCCGCTGTGGGACCTGGG + Intronic
1023729684 7:43178711-43178733 AACCTCTAGCTGTGGCACCTTGG - Intronic
1024045378 7:45582322-45582344 CACCTCCAGCTCCGTGACCTTGG + Intronic
1028120691 7:87053562-87053584 CCCCTTTAGCTGGGTGCCCTTGG + Intronic
1030536325 7:110771491-110771513 CACTTTCAGCTGTGTGACCTTGG + Intronic
1031121610 7:117728555-117728577 CACTATTACCTGTGGGACCTTGG - Intronic
1031645820 7:124223559-124223581 CACCTTTTGCTGATGGAGCTTGG - Intergenic
1034030028 7:147751126-147751148 CACAATTAGCTGTGTGACCTTGG + Intronic
1034888281 7:154816095-154816117 CACCTACAGCTTCGCGACCTTGG + Intronic
1037477663 8:19273185-19273207 CATCTCTAGCTGAGAGACCTTGG + Intergenic
1044283512 8:90384265-90384287 CACCTTCAGCTGAGGGATCAGGG - Intergenic
1045067659 8:98465234-98465256 CACCTCTAGCTGAGAGACCTAGG - Intronic
1045344693 8:101283496-101283518 CACTATTAGCTGTGTGACCTTGG - Intergenic
1046844802 8:118903766-118903788 CAGCTTTACCTGGGGGTCCTAGG - Intergenic
1047547347 8:125831690-125831712 CACCTTTAACTGTAAGACCTTGG - Intergenic
1049140176 8:140947397-140947419 CACTTTTAGCTGTGGAACTTTGG - Intronic
1049337513 8:142094291-142094313 CACCTGCAGCTGTGTGACCTTGG + Intergenic
1049364399 8:142229869-142229891 CATCTTGAGCTGAGGGATCTCGG + Intronic
1049959523 9:725096-725118 CTCCTTTAGCTGTGGGACATGGG - Intronic
1050405259 9:5302215-5302237 CACCTTTAGCTATGGAACCTAGG + Intronic
1050408570 9:5337389-5337411 CACTTTTAGCTATGGAACCTAGG + Intronic
1050741177 9:8822750-8822772 CATTGTCAGCTGCGGGACCTTGG - Intronic
1051861021 9:21624850-21624872 CACCTCTAGGTGCCAGACCTGGG - Intergenic
1053085112 9:35212935-35212957 GACCTTGAGCTGTGGGACCTTGG + Intronic
1055621634 9:78131760-78131782 CACTTTTAGTTGTGGGCCCTAGG - Intergenic
1056786731 9:89597888-89597910 CACCATTGGCTGTGTGACCTTGG + Intergenic
1057748611 9:97772119-97772141 CACTTTTGGCTGTGTGACCTTGG - Intergenic
1057785613 9:98085328-98085350 CACCACTAGCTGTGCGACCTTGG + Exonic
1060103031 9:120856850-120856872 CACATTTAGTTGCAGCACCTGGG + Exonic
1060223058 9:121774484-121774506 CACCCGTTGCTGGGGGACCTGGG - Intronic
1061121300 9:128644231-128644253 CACCTTTTGCTGTGTGACCTTGG - Intronic
1061931080 9:133833575-133833597 CACCTGCAGGTGAGGGACCTGGG - Intronic
1187195792 X:17082293-17082315 CAAATCTAGCTGGGGGACCTAGG + Intronic
1192421082 X:71031595-71031617 CTCCTTTAGCTGAGAGACCTAGG - Intergenic
1195705437 X:107734957-107734979 CAGCTCTAGCTGTGTGACCTTGG - Intronic
1197068884 X:122269262-122269284 CACAGTTAGCTATGGGACCTAGG + Intergenic
1197069060 X:122271451-122271473 CACAATCAGCTGTGGGACCTAGG - Intergenic
1197324868 X:125080571-125080593 CACCTTTAGCTAAGGGACTTAGG - Intergenic