ID: 967269645

View in Genome Browser
Species Human (GRCh38)
Location 3:187722451-187722473
Sequence CCCCAAAGCCTGCTGAAGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967269645_967269652 10 Left 967269645 3:187722451-187722473 CCATGCTTCAGCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 215
Right 967269652 3:187722484-187722506 GCAGGTCAGTGGCTGACACGCGG 0: 1
1: 0
2: 0
3: 10
4: 209
967269645_967269649 -8 Left 967269645 3:187722451-187722473 CCATGCTTCAGCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 215
Right 967269649 3:187722466-187722488 CTTTGGGGAGCTCCGGAGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 473
967269645_967269650 -1 Left 967269645 3:187722451-187722473 CCATGCTTCAGCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 215
Right 967269650 3:187722473-187722495 GAGCTCCGGAGGCAGGTCAGTGG 0: 1
1: 0
2: 0
3: 17
4: 246
967269645_967269653 23 Left 967269645 3:187722451-187722473 CCATGCTTCAGCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 215
Right 967269653 3:187722497-187722519 TGACACGCGGTATTGCACCTTGG 0: 1
1: 0
2: 0
3: 3
4: 37
967269645_967269654 29 Left 967269645 3:187722451-187722473 CCATGCTTCAGCAGGCTTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 215
Right 967269654 3:187722503-187722525 GCGGTATTGCACCTTGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967269645 Original CRISPR CCCCAAAGCCTGCTGAAGCA TGG (reversed) Exonic
900090107 1:916553-916575 CCCCAGAGCCTGCTCAGGCCTGG - Intergenic
900099387 1:954904-954926 CACTAAAATCTGCTGAAGCATGG + Intronic
900115535 1:1026374-1026396 CCCCACAGCCTGCAGAAGGCGGG + Intronic
900415462 1:2532581-2532603 CTCCAAAGCCTGCGGGAGCAGGG - Intergenic
902221344 1:14967786-14967808 CCCCAGAGCCTCCAGAAGAAAGG + Intronic
903162555 1:21499628-21499650 CTCCACAGCCTGCTGAATCTTGG + Intergenic
903468089 1:23566468-23566490 CTCCTAAGCCTGCTGATGCTTGG - Intergenic
903871999 1:26442596-26442618 CCCCAAAGCTGGGTGAAGCTAGG - Intronic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
905863765 1:41366147-41366169 CCCCCCAGCCTGCTCCAGCAGGG + Intronic
906273741 1:44501029-44501051 CCCCACAGCCTTCTGCAGCCTGG - Intronic
907102711 1:51851247-51851269 CCCAATACCTTGCTGAAGCAAGG - Intronic
909600829 1:77459353-77459375 CCCCAAAACTGGCTGCAGCAGGG - Intronic
910162644 1:84290710-84290732 CCAAAAAGCCTGCAGAACCATGG + Intergenic
910721673 1:90293649-90293671 GCCCAGAGCCTTCTCAAGCAGGG + Intergenic
912676975 1:111691384-111691406 TCCCAACGCCTCCTGAACCAAGG - Exonic
915457483 1:156050542-156050564 CCCCAAAGCCAGCTGTGGGAAGG + Exonic
915468726 1:156113510-156113532 CCCCAGAGCCAGCTGCAGAATGG + Intronic
915937880 1:160099321-160099343 CTGCAAACCCTGCTGAAGTAGGG + Intergenic
917378315 1:174375335-174375357 ACCCAAAGCAAGCAGAAGCAAGG + Intronic
918301215 1:183205709-183205731 CACAAAAGCCTGATGACGCAGGG + Intronic
920958861 1:210646056-210646078 ACTCAAAACTTGCTGAAGCACGG - Intronic
922919742 1:229292497-229292519 CCCCACAGCCTCCTAAGGCAGGG - Intronic
923285410 1:232490089-232490111 CCCCACTGCCTCCTGAATCAAGG + Intronic
1066111001 10:32197025-32197047 GCCCAAAGCCAGCAGAAGAAAGG - Intergenic
1068359176 10:55953495-55953517 CCCCATATCCTGATGAAACATGG - Intergenic
1069855161 10:71436156-71436178 CTCCAAAGCATTCGGAAGCAGGG - Intronic
1075876242 10:125808175-125808197 CCACAAAGCGTGCTGATGAAGGG + Intronic
1076909891 10:133381716-133381738 CCCCAGAGCCAACTGAGGCAGGG - Intronic
1077100107 11:818926-818948 CCCCAAAGCCTGAACAGGCAGGG + Exonic
1077700183 11:4434143-4434165 CCACAAAGGGTACTGAAGCAGGG - Intergenic
1077744219 11:4882479-4882501 CCCCAAAAACTGCTGATCCAAGG - Exonic
1080865786 11:36193731-36193753 CCCCAAAGGCTGCTAAGACAAGG - Intronic
1081871561 11:46384865-46384887 CCCCGCAGCTCGCTGAAGCAGGG + Intergenic
1089002044 11:115060144-115060166 CCCCAAGCCCTGCTGAGGAAGGG - Intergenic
1089059166 11:115612189-115612211 CCCCAAGACCTGCTGGAGCTGGG - Intergenic
1089986754 11:122821633-122821655 CCACAAAGGCTTCTGAAGCTAGG + Intergenic
1091381994 12:67607-67629 CCCCAAAACCTTCTCAAGCAGGG - Intronic
1091725874 12:2846072-2846094 CCCCATGGCCTGCTGGAGCTAGG + Intronic
1091756571 12:3056293-3056315 CCCCAAAGCCTCCTGACACAAGG + Intergenic
1091882474 12:3990792-3990814 CGCCAAGGCCTGCTGGGGCAGGG - Intergenic
1092125102 12:6069554-6069576 CCCCACTGCCTGCTGAGTCATGG + Intronic
1093779752 12:23121675-23121697 CACCAAAGGCTGGTGAACCAAGG - Intergenic
1095383510 12:41622576-41622598 ACCCAAAGCCAGCAGAAGAAAGG + Intergenic
1097988183 12:65806163-65806185 CCCCAAAGCCACCTTAGGCAAGG + Intergenic
1098377681 12:69835252-69835274 CCCCAAACCCTGCCAAGGCATGG - Intronic
1099104692 12:78483802-78483824 CCCCATAGCCTGGGGCAGCAAGG + Intergenic
1103560467 12:121790764-121790786 CCCCAGACCCTGCTGCAGCGGGG - Intronic
1105252127 13:18708781-18708803 GCCCAGAGCCTTCTCAAGCAGGG - Intergenic
1105394320 13:20014684-20014706 ACCCAAAGCCAGCAGAAGAAAGG - Intronic
1105997788 13:25688690-25688712 CCCCAGCGCCTGCTGATTCAGGG + Intronic
1107448104 13:40486048-40486070 GCCCCAAGACTTCTGAAGCAAGG + Intergenic
1108791669 13:53976272-53976294 TCCCAAAGCCAGCAGAAGAAAGG + Intergenic
1109980514 13:69900344-69900366 CCTCAATGCATGCTGCAGCATGG + Intronic
1112991342 13:105517446-105517468 CCCCTAAACCTTCTGAAACATGG + Intergenic
1115526416 14:34284829-34284851 CCCCAATGCCTGCTGGATAAAGG + Intronic
1121730868 14:96186155-96186177 CACCCAAGCCCTCTGAAGCATGG - Intergenic
1122274428 14:100584336-100584358 ACTCAAGGCCTGCTGAGGCAAGG + Intronic
1122803978 14:104247526-104247548 CCCCAAAGCCCTCTGCAGCCTGG - Intergenic
1124696288 15:31867429-31867451 CCCCCAAGCCTGGTGGAGGAGGG - Intronic
1127053447 15:55108511-55108533 CCCCAAAGACTGTAGAAACAGGG + Intergenic
1127961694 15:63895207-63895229 CCCCATAGCTTGCTGAATAAAGG + Intergenic
1129174842 15:73832559-73832581 CCCCTCAGTCTCCTGAAGCAGGG + Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132353964 15:101157942-101157964 GCCCAGAGCCTGGTGCAGCAAGG + Intergenic
1132841706 16:1981235-1981257 CCCCAGAGCCCTCTCAAGCACGG - Exonic
1132945320 16:2528983-2529005 CCCCCAAGCAGGCTGCAGCATGG + Exonic
1135973359 16:27088383-27088405 CCCCAAAGCCTCCTCTAACATGG + Intergenic
1138222365 16:55263526-55263548 TCCCAAAGCCGGATGCAGCAGGG - Intergenic
1142182388 16:88677586-88677608 CCCCAAATCCTGCTGTCTCAGGG + Intergenic
1142529181 17:567360-567382 CATCAAAGCATGCTGATGCAGGG - Intronic
1145224577 17:21117189-21117211 CCCCACCGCCTGCTGGAGGAGGG + Intergenic
1148444101 17:47727309-47727331 CCCCAGTGCCTCCTGAAGCTTGG + Intergenic
1148711386 17:49683822-49683844 CCCCAAAGAATTCTGAAGAAGGG - Intergenic
1149382953 17:56111894-56111916 CGGCACAGCCTGCTGAACCAAGG + Intronic
1149517667 17:57292645-57292667 CCCCAAAGGATGCTGAGGCCTGG + Intronic
1151986750 17:77548614-77548636 CCCCAAAGCCCGGTGAGGAAAGG - Intergenic
1152122311 17:78426362-78426384 CCCTAGAGCCTGCAGGAGCATGG - Intronic
1152601547 17:81264767-81264789 CCCCAAGGCCTGCTGAGGCTCGG - Intronic
1155498351 18:26464221-26464243 CCCCAGAGCCTCCAGAAGGAAGG - Intronic
1157163279 18:45334849-45334871 CCCCAACGCCTGCTGGCGGAGGG + Intronic
1159637477 18:70822672-70822694 CCCCAAAGCCTGCACAAAAATGG + Intergenic
1159679808 18:71335039-71335061 CCCCAAAGCCAGTTGAACCTAGG - Intergenic
1162190415 19:8941325-8941347 CCACAAAGCCTACTGGAGCTTGG + Intronic
1163315129 19:16536186-16536208 CCCCAAGGGCTGGAGAAGCAAGG - Intronic
1164114312 19:22202858-22202880 CCCCAGGGCCTGCTGAAGGTAGG + Intergenic
1164864937 19:31596946-31596968 CCCCAAAGCTTGCTGCAGTTGGG + Intergenic
1165345292 19:35243986-35244008 ACCCAAAGCCAGCAGAAGAAAGG + Intergenic
1165446444 19:35859475-35859497 CTCCAGACCCTGCTGAAGGAAGG + Exonic
1166856899 19:45786717-45786739 CAGTACAGCCTGCTGAAGCAGGG - Exonic
1167574814 19:50312902-50312924 CCCTAAACCCTGGTGAAGCAGGG - Intronic
1168395819 19:56047263-56047285 CCCCAAACCCAGCAGAAGAAAGG - Intronic
1168411154 19:56141264-56141286 GCGCAAAGCCTGCTGGGGCATGG + Exonic
926207115 2:10841650-10841672 CCCCAAAGACAGCAGAAGAAGGG - Intergenic
926215938 2:10905377-10905399 CCCCAGACACTGCTGAAGCCTGG + Intergenic
926262091 2:11274223-11274245 ACCCAAAGCCATCAGAAGCAAGG + Intronic
928245634 2:29624576-29624598 CACCGAGGCCTGCTGGAGCAGGG + Intronic
930725179 2:54675115-54675137 CCCCAATGCCTGGTGGAGAAGGG - Intergenic
931384126 2:61781697-61781719 CCCCAAAGCAAGCTGAAGAAAGG + Intergenic
932234359 2:70109137-70109159 CCCCAAAGGCAGCCGATGCAGGG - Intergenic
935953843 2:108354945-108354967 CCCCAATGCCTGCAGGGGCAGGG - Intergenic
937453717 2:122023623-122023645 AACCACAGCCTGCTGGAGCAGGG - Intergenic
938161372 2:128987401-128987423 CCCCAGAGGCTGCTGAAGCATGG + Intergenic
939431118 2:142109366-142109388 CCCCAAAGCCTGCTGACAATTGG + Intronic
939831760 2:147080873-147080895 CTTCAATGCCTGATGAAGCATGG + Intergenic
940708183 2:157129733-157129755 CCCCAAAGCTAGCAGAAGCTAGG + Intergenic
942406136 2:175657653-175657675 CCCCAAAGCAAGCAGAAGGAAGG - Intergenic
943105145 2:183536662-183536684 CCCCAAGCTCTGCTGAAGAATGG - Intergenic
943205651 2:184891121-184891143 TTCCAAAGCCTGCAGAAACAAGG - Intronic
944291842 2:198016981-198017003 CACCAAAATCTGCAGAAGCACGG - Intronic
946908790 2:224441275-224441297 CCCGCAAGCCTGCAGAGGCAGGG - Intergenic
947222915 2:227811554-227811576 ACCCAAAGCATGCAGAAGGAGGG - Intergenic
947444579 2:230154374-230154396 ACCCATAGCCCGCTGAACCAGGG - Intergenic
947603390 2:231468276-231468298 CCCCTGAGCCTGCTGGAGGAGGG + Intronic
948254572 2:236556600-236556622 CCCCAAAGCCTCCAGAAGGAAGG + Intergenic
948601228 2:239108461-239108483 CTCCTCAGCCTGCTGCAGCAGGG - Intronic
948873790 2:240817114-240817136 TCCCAAACCCTCCTGTAGCAGGG + Intronic
948892640 2:240914857-240914879 CGTCAAAGCCATCTGAAGCAGGG - Intergenic
949053972 2:241914629-241914651 CCCAAAAGCCAGCTGAGGCCAGG - Intergenic
1168835968 20:877743-877765 TCCCAAAGCAAGCTGGAGCAAGG + Intronic
1169578264 20:6990431-6990453 CCCCAGAGCCTCCGGAAGGAGGG + Intergenic
1169936514 20:10889574-10889596 CCTCAAAGCCTGCTTAAAAAAGG - Intergenic
1171168537 20:22994685-22994707 CGCCAAAGCCTTCTGAAATAGGG - Intergenic
1172755903 20:37284149-37284171 CCTCAATTCCTGCTGGAGCATGG - Intergenic
1172950483 20:38720249-38720271 CCACCAAGCCTTGTGAAGCAAGG - Intergenic
1175820138 20:61904639-61904661 CCCCACAGCCTCCTGAAGAACGG + Intronic
1176283206 20:64327226-64327248 CCCCAAAACCTTCTCAAGCAGGG + Intergenic
1180635958 22:17263211-17263233 CCGCACTGCCTGTTGAAGCAGGG + Intergenic
1181455601 22:23058657-23058679 CCCCATAGCCCCCTGAAGCTGGG + Intergenic
1181577013 22:23801605-23801627 CCCCAAAGCTGGAAGAAGCAAGG - Intronic
1181782769 22:25205090-25205112 CCCCCAAACCTGCTGCAGGAGGG - Intronic
1182363099 22:29759077-29759099 CCCCAAGGCCTGGTGAAGGTCGG + Intronic
1182613668 22:31570869-31570891 CCCGAAAGCCAGGTGAAGGAAGG + Intronic
1184754206 22:46507313-46507335 CCACAATGCCTGCTGAAGTCGGG + Intronic
949890249 3:8728414-8728436 CCCCAGAGCCTGCTCCAGCATGG + Intronic
950871739 3:16235338-16235360 ACCTGAAGCCTGATGAAGCAAGG + Intergenic
951427375 3:22563391-22563413 CCCTAGAGCCTGCAGAAGAAAGG + Intergenic
952758509 3:36893212-36893234 CCTCAAAGCCTGCTGAGGACAGG + Intronic
954213646 3:49112155-49112177 CCCCAGAGCCTGGTAAAGTAGGG + Intronic
954400459 3:50316975-50316997 AGCCAGAGCCTCCTGAAGCAGGG + Intergenic
954659157 3:52217510-52217532 ACCCAGAGCCAGCAGAAGCAAGG + Intergenic
956249298 3:67219010-67219032 ACCCAAGGCGTGCTGAAGCTAGG + Intergenic
956723161 3:72135920-72135942 CCCCAAAGCCAGCTGCAGTGGGG - Intergenic
956738241 3:72255547-72255569 TCCCCAAGCCTGCTGGGGCAAGG + Intergenic
959325455 3:104931127-104931149 ACCCAAACCCTGCAGAAGAAAGG - Intergenic
959385665 3:105702274-105702296 CGCCAATGCCTCTTGAAGCATGG - Exonic
962991063 3:140577903-140577925 CCCCAAAGCCCACTGAAGACGGG + Intergenic
963929317 3:150985820-150985842 ACCCAAAGCCAGCAGAAGGATGG - Intergenic
964622446 3:158731308-158731330 CCACAAAGCCTGCAGACACACGG - Intronic
967269645 3:187722451-187722473 CCCCAAAGCCTGCTGAAGCATGG - Exonic
968559403 4:1270372-1270394 ACCCAAAGCTAGCAGAAGCAGGG - Intergenic
969052189 4:4380850-4380872 CCCCAAACCCAGCAGAGGCAGGG - Intronic
969460691 4:7327247-7327269 CCCCAAAGCCTCCTGACTCCTGG - Intronic
974499148 4:62675769-62675791 ACCCAAAGCCTACAGAAGGAAGG - Intergenic
975040998 4:69744062-69744084 CCACGAAGCCAGCGGAAGCAGGG - Intronic
976452378 4:85205596-85205618 CCCCAAACCCAGCAGAAGAAAGG - Intergenic
978551351 4:109930655-109930677 CCCCAAGGCCTGCAGAAGACAGG + Intronic
978677006 4:111330652-111330674 CCCCAGAGCCTACTTAAGGATGG + Intergenic
979498875 4:121416174-121416196 ACCCAAAGCCAGCAGAAGAAAGG - Intergenic
981045013 4:140256856-140256878 CACCAAAGCCTGATGAAACATGG + Intergenic
982409006 4:155052242-155052264 CCCCAAAGCAGGCAGAAGGAAGG + Intergenic
983023226 4:162705585-162705607 CCCCCATGGCAGCTGAAGCAGGG + Intergenic
983806551 4:172000528-172000550 TCTCAAAGCTTGCCGAAGCAGGG + Intronic
984009856 4:174357519-174357541 ACACAAAGCCTGCTGAAGTATGG + Intergenic
986980608 5:13444090-13444112 CTGCAAAGCCTGCTGTAGCAGGG - Intergenic
989461631 5:41706107-41706129 CCCCAAAGCTAACTGAAGAAAGG - Intergenic
992069425 5:73135884-73135906 CCCCAACCCCTGGTGAATCAGGG + Intergenic
992267633 5:75034216-75034238 AGCCAAAGCCAGCTGAACCAAGG - Intergenic
995317660 5:110794665-110794687 ACCCAAACCCTGCAGAAGAAAGG - Intergenic
998399794 5:141842796-141842818 CCCCAAAGCCCTGTGAAGCTTGG - Intergenic
999142181 5:149369783-149369805 CCCTAAAGCCTGATTTAGCAAGG - Intergenic
1000379106 5:160612985-160613007 CCCCAAAGCCATGTGAAGCCAGG + Intronic
1001579579 5:172789671-172789693 GCCCTAAGCCTGTTGGAGCAGGG + Intergenic
1003151253 6:3551386-3551408 ACCCAAAGCACGCAGAAGCAAGG - Intergenic
1003967967 6:11271361-11271383 TGCCAAAGGCAGCTGAAGCAGGG - Intronic
1005815090 6:29544320-29544342 CCCCAAAGCAAGCAGAAGAAAGG - Intergenic
1006199213 6:32271605-32271627 GCCCAAAGCCAGCAGAAGAAAGG + Intergenic
1006502998 6:34469839-34469861 CCCCAGAGCCAGCTGAGGCCAGG - Intronic
1008128509 6:47694652-47694674 CCACAAAGGCTGCTGGAGCCTGG - Intronic
1011246119 6:85322966-85322988 CCCAAAATCCAGCTGAAGAATGG + Intergenic
1013195545 6:107841948-107841970 ACCCAAAGCAAGCTGAAGGAAGG - Intergenic
1014211256 6:118710631-118710653 CCCCAAATCCCACTGAAACAAGG - Intergenic
1015544925 6:134352101-134352123 TCCCACTGCCTGCTGAATCAAGG + Intergenic
1016549449 6:145260806-145260828 CCCCCAATCCTGCAGAGGCAGGG - Intergenic
1018009659 6:159658412-159658434 ACCCAAACCCTGCAGAAGAAAGG + Intergenic
1021049207 7:15961587-15961609 CACCAAAGCCTGTTGAGGAATGG + Intergenic
1021905246 7:25326944-25326966 GCCCAAACCCTGCTGACACAAGG + Intergenic
1021975291 7:26006434-26006456 CCCCCAATCCAGCTGAAGCCCGG - Intergenic
1023485521 7:40682166-40682188 CCCCACAGCCTGCTAAAAGAGGG + Intronic
1026453279 7:70548159-70548181 CCCGAAAGTCTGCTGAATAAGGG + Intronic
1031917795 7:127579322-127579344 CCACAAAGCCTGCTTAATCTGGG - Intergenic
1032397338 7:131600202-131600224 ACCCCAAGCACGCTGAAGCAGGG - Intergenic
1032859300 7:135862303-135862325 CCCCAAGGCATGCTGGATCATGG + Intergenic
1033057050 7:138066306-138066328 GCCCAGAGCCTGCTCAAGGAGGG - Intronic
1033623595 7:143085884-143085906 ACCCAAACCCTGCAGAAGAAAGG + Intergenic
1036442998 8:8797831-8797853 CCCCAGAGCCCACCGAAGCAAGG + Intronic
1036939782 8:13040369-13040391 CCCCAATGCCTCCAGAAGCCAGG + Intergenic
1037472641 8:19225532-19225554 TCCAACAGCCTGCTGATGCAAGG + Intergenic
1039600703 8:38834597-38834619 CCCCAAATGCTGCTGGAACATGG + Intronic
1040981237 8:53248064-53248086 CCCCAAAGCCTGATGAGTGAGGG + Intronic
1041507455 8:58615783-58615805 ACCCAAAGCAAGCTGAAGGAAGG + Intronic
1042323375 8:67502513-67502535 ACCCAAAGCATGCAGAAGGAAGG - Intronic
1045121958 8:99047553-99047575 ACCCAAAGCCAGCAGAAGAAAGG - Intronic
1046995732 8:120520095-120520117 CCTCAAAGCCTGCTAATCCATGG - Intronic
1047645979 8:126870071-126870093 CCTCATAGCCTTCTGGAGCAGGG + Intergenic
1049123697 8:140766060-140766082 CCCAAAATCCTGCTGCAGCAGGG - Intronic
1049295718 8:141835393-141835415 ACCCAAAGCCAGCAGAAGGAAGG - Intergenic
1050090661 9:2014959-2014981 CCCCAAGCCCTGCTGGAGCTGGG - Intergenic
1055732076 9:79288551-79288573 CCTCCAAGCATGCTGCAGCAAGG + Intergenic
1056691046 9:88808969-88808991 CCCCAGAGCCTGTTGAAGTTAGG + Intergenic
1057401168 9:94724892-94724914 CCCCAAAGCCTACAGCAGCCGGG - Intergenic
1057411266 9:94818250-94818272 TTCCTAAGCCTACTGAAGCAAGG - Intronic
1057750766 9:97791003-97791025 CCCCAAAACCTGCTCCAGCAAGG + Intergenic
1058587223 9:106522398-106522420 ACCCAAAGCTAGCTGAAGAAAGG + Intergenic
1062268227 9:135697047-135697069 CCCCAAAGCAGGCTGGGGCATGG - Intronic
1062387464 9:136318654-136318676 CCCCGCAGCCTGCAGAAGTAGGG + Intergenic
1062419013 9:136470180-136470202 CCCCAGAGCCTGCGCAAGCCAGG + Intronic
1062600038 9:137315482-137315504 CCCCCAAGTCTGCTGCAACAGGG - Intronic
1186078255 X:5903599-5903621 CCCCAGATCCTGATGGAGCAAGG - Exonic
1187431524 X:19229288-19229310 CCCCCAAGCCTGCTAAAGCTGGG - Intergenic
1188427721 X:30068111-30068133 CCCCACAGCCACCTGTAGCAGGG - Intergenic
1192968001 X:76200659-76200681 GCCCAAAGCCAGCAGAAGAAAGG - Intergenic
1193100237 X:77602880-77602902 ACCCAAAGCTTGCAGAAGGAAGG + Intronic
1193329711 X:80222668-80222690 CTCCAAGGCATGCTGATGCAAGG - Intergenic
1193330154 X:80226835-80226857 CTCCAAGGCATGCTGATGCAAGG + Intergenic
1193919417 X:87407091-87407113 CCCCCAAGCCTGCAGAGACATGG + Intergenic
1196675493 X:118416208-118416230 ACCCAAAGCCAGCAGAAGAAAGG - Intronic
1197551120 X:127893916-127893938 CCCGAAAACCAGCAGAAGCAAGG - Intergenic
1197766953 X:130065580-130065602 CCCCCATTCCTGCTCAAGCATGG - Exonic
1199021652 X:142885224-142885246 CCCCAAAGCCTGAGAATGCAGGG - Intergenic
1199753750 X:150845600-150845622 CCCCAAAGCCAGAAGATGCAAGG + Intronic
1200155894 X:153974789-153974811 CCCCATTGCCCTCTGAAGCATGG - Intronic
1201517088 Y:14829975-14829997 CCCCAGATCCTGATGGAGCAAGG + Exonic